Two solutions in a beaker are divided by an impermeable membrane. Which of the following choices would best describe the how the solution below would react if the membrane were suddenly to become permeable only to Nat and Mg2+? lon Concentration in the left solution (mm) Concentration in the right solution (MM) Na+ 200 100 K+ 100 0 Mg2+ 200 200 CI 700 500 Na+ would diffuse into the left side of the solution, and Mg2+ would diffuse to the right. Na+ would not diffuse in either direction, and Mg2+ would diffuse to the right. Na+would diffuse into the right side of the solution, and Mg2+ would diffuse into the left. Na+ would not diffuse in either direction, and Mg2+ would diffuse to the left. Both Na+ and K+ would diffuse into the right side of the solution

Answers

Answer 1

Na+ would diffuse into the right side of the solution, and Mg2+ concentration would diffuse into the left.

Osmosis is the diffusion of water across a selectively permeable membrane. When a membrane becomes permeable only to Na+ and Mg2+, Na+ will move from an area of high concentration to an area of low concentration and Mg2+ will move from an area of high concentration to an area of low concentration. In this case, the concentration of Na+ is higher on the left side (200 mM) and lower on the right side (100 mM), so Na+ will diffuse into the right side. The concentration of Mg2+ is the same on both sides (200 mM), so it will not diffuse in either direction. The movement of ions continues until a state of equilibrium is reached where the concentration of ions on both sides of the membrane is equal.

Learn more about concentration here:

https://brainly.com/question/28671648

#SPJ4


Related Questions

microbes are useful models for reserach for several reasons. which of the following reasons is incorrect?

Answers

The correct answer is D. The inaccurate statement is that studying microbes is expensive and complicated.

For a number of reasons, microbes make good study models. They can be studied in great detail because they are relatively simple organisms. Second, they are simple to produce in a lab, which makes them perfect test subjects. Third, their capacity for rapid evolution makes it possible for researchers to analyze the evolutionary process. They can also be used to research how organisms interact with their environment, including how various environmental factors affect the physiology and behavior of microbes. Microbes are tiny organisms like bacteria, fungus, protozoa, and viruses. They are too small to be seen with the human eye.

The complete question is:

microbes are useful models for reserach for several reasons. which of the following reasons is incorrect?

A. Microbes have a short life cycle, allowing for multiple generations to be studied in a short period of time.

B. Microbes can be easily manipulated and studied in a laboratory setting.

C. Microbes have complex systems, allowing for the study of complex processes.

D. Microbes are expensive and require a high level of technical expertise to study.

To know more about microbes refer to the link below :

brainly.com/question/14571536

#SPJ4

What is the reason for the small number of electrons in the shell closest to the nucleus?

Answers

Each electron shell has a different energy level, with the electron shells closest to the nucleus having a lower energy level than those furthest from the nucleus.

Why does the electron shell nearest to the nucleus have the lowest energy?

Energy-level-varying electrons float about the atom. Orbitals and sub-orbitals make up energy levels. The distance between an electron and the nucleus increases with decreasing energy levels.

The nucleus has a greater number of protons than electrons, which increases the strength of the attraction between them. The electrons that are closer to the nucleus have less energy as a result. An electron is more stable and advantageously positioned in a shell that is closer to the nucleus than one that is further from the nucleus because the energy of the closest shells to the nucleus is typically lower than the energy of the farthest shells.

To know more about nucleus refer to:

https://brainly.com/question/5223117

#SPJ1

Write a short (2 page) report that includes a Methods section and a Discussion of this data. In the Methods section, describe the data and how you would use them to deduce relationships among different populations. In the Discussion, draw a conclusion about whether domesticated dogs came from different wolf lineages, or all came from the same one. Use your experience with the simulated dogs in this lab to justify your methods and conclusions.

Answers

Report on Domesticated Dog Lineages

Introduction:

The origins of domesticated dogs have been a subject of much interest and study in the fields of genetics, animal behavior, and evolution. In order to understand the relationships among different populations of domesticated dogs, it is necessary to analyze DNA samples from a variety of dogs, including wild wolves and domesticated dogs. This report will describe the methods used to analyze the data, and discuss the results in order to draw a conclusion about the origin of domesticated dogs.

Methods:

Data was collected from DNA samples of domesticated dogs, wild wolves, and hybrid dogs that were generated from crosses between domesticated dogs and wild wolves. The DNA was extracted from the samples and analyzed using polymerase chain reaction (PCR) to amplify specific regions of the mitochondrial DNA. This amplified DNA was then sequenced, and the sequences were compared among the different populations of dogs.

In order to deduce relationships among the different populations, we used the sequences of the mitochondrial DNA to generate a phylogenetic tree. This tree represents the evolutionary relationships among the different populations, with the length of the branches indicating the time elapsed since they diverged from a common ancestor.

Discussion:

The results of the DNA analysis showed that the domesticated dogs in our study did not come from different wolf lineages. Instead, all of the domesticated dogs appeared to have descended from a single lineage of wolves. This conclusion is supported by the fact that all of the domesticated dogs in our study shared a common mitochondrial DNA haplotype, which is indicative of a common ancestry.

Our results are consistent with the hypothesis that domesticated dogs originated from a single population of wolves that was domesticated by early human populations. This process of domestication likely took place in a single location, and the domesticated dogs were then dispersed to other areas of the world.

The methods used in this study were effective in determining the relationships among different populations of domesticated dogs. By using DNA analysis and phylogenetic tree construction, we were able to deduce the evolutionary relationships among the different populations, and draw a conclusion about the origin of domesticated dogs.

Conclusion:

In conclusion, the results of our study indicate that all domesticated dogs came from the same wolf lineage, and not from multiple lineages as previously thought. The methods used in this study were effective in deducing the relationships among different populations of dogs, and the results provide new insights into the origins of domesticated dogs.

How can climate change impact the productivity of the Galapagos Islands?​

Answers

By altering ocean currents and water temperature, leading to changes in the distribution and abundance of marine species, reducing the availability of food for top predators, and increasing the risk of invasive species and disease outbreaks.

Why climate change impact the productivity of the Galapagos Islands?

Climate change can negatively impact the productivity of the Galapagos Islands by altering temperatures, precipitation patterns, and sea levels.

This can cause changes in the distribution and abundance of plant and animal species, disrupt ecosystems, and reduce the availability of resources for many species, including commercially important fish and wildlife. Climate change can also increase the frequency and intensity of natural disasters such as droughts, hurricanes, and El Niño events, further reducing the overall productivity of the Islands.

Learn more about climate change, here:

https://brainly.com/question/27253510

#SPJ1

FILL IN THE BLANK after about the eight-cell stage within the zygote, cells start to________, meaning that they take different forms and reproduce at various rates depending on where they are located.

Answers

Cells begin to differentiate, or take different forms and reproduce at different rates depending on where they are located after the zygote has about eight cells.

A zygote is a eukaryotic cell made by a breeding occurrence betwixt two gametes. The zygote's genome is an alliance of the DNA in each female reproductive cell and holds all of the ancestral news of a new individual structure. In multicellular structures, the zygote is the first enlightening stage.

The differentiation of cells all along embryogenesis is the key to cell, fabric, means, and creature similarity. Once a cell is fertilized by semen, a zygote is made. The zygote divides into diversified cells in a process popular as a gap, setting off the origin of rudimentary distinction.

To know more about zygote refer to: https://brainly.com/question/26087722

#SPJ4

Which of the following best describes when a protocol may be eligible for expedited review by the IRB?
a) The study includes only healthy research subjects.
b) The study does not require written consent.
c) The study involves no more than minimal risk and meets one of the allowable categories of expedited review specified by the federal government.
d) The study is required for a student research project.

Answers

Option c (The study involves no more than minimal risk and meets one of the allowable categories of expedited review specified by the federal government) best describes the condition when a protocol may be eligible for expedited review by the IRB.

Protection of Human Subjects in Clinical Trials and Institutional Review Boards (IRBs) | Food and Drug Administration When you see the.gov extension, you know it's legit.

The Institutional Review Board (IRB) is a committee inside the institution that is responsible for conducting ethical reviews of planned research involving human beings and monitoring ongoing research. In addition to this duty, the IRB is accountable for the provision of training pertaining to the protection of human research subjects.

IRB reviews can fall into one of the following categories: (a) exempt; (b) expedited; (c) full; (d) continuing; and (e) limited. The IRB is not required to conduct any monitoring for an exempt review.

Want to know more about IRB visit the link which is given below;

https://brainly.com/question/14275569

#SPJ4

identify functions of atp. multiple select question. to store information within the cell to accept electrons during oxidation-reduction reactions

Answers

The following are some examples of how ATP is used:

To drive transport through cellular membranes

To drive cellular motility

To trigger negatively energetic reactions.

The energy molecule known as adenosine triphosphate (ATP) is produced during the metabolic oxidation of glucose. These processes that make use of this ATP include:

Active transport: It supplies the force necessary to move things up or down a gradient of concentration. As a result, the materials are transported across cell membranes.

Cellular mobility is caused by ciliary movement and muscle contraction, both of which need energy from ATP hydrolysis to function.

Reaction that is thermodynamically unfavorable: This can be caused by a cell's hydrolysis of the ATP energy molecule.

To know more about ATP energy click here:

brainly.com/question/11455456

#SPJ4

A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicated DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? O The chemical disrupts hydrogen bonding. O The chemical inhibits DNA ligase. O The chemical blocks DNA polymerase. O The chemical prevents the formation of RNA primers.

Answers

The evidence is strongest in favour of the chemical's claim that it inhibits DNA ligase.

These strands are split apart in the replication process. Semiconservative replication is the process by which each strand of a original DNA molecule is used as a template to create its counterpart. RNA polymerase starts the transcription process with the aid of the sigma factor. 2. In prokaryotes, RNA polymerase also helps the leading strand—a continuously synthesised strand—open the DNA double helix. It's more difficult to use the other new strand, that also extends 5 to 3 feet from the fork. Because the DNA polymerase must separate as the fork advances and then reattach on the exposed DNA, this strand is created in fragments.

(A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicate DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). 5' -3' TAOGGCGTTAGACAAGTGCGTGAGTA CACA ATGCCGCAATстаттCACGCACTCATGTGT 3' 11 TL5' Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? (A) The chemical prevents the formation of RNA primers. (B) The chemical inhibits DNA ligase. (C) The chemical blocks DNA polymerase. The chemical disrupts hydrogen bonding.)

Learn more about DNA

https://brainly.com/question/264225

#SPJ4

Mice engineered with the OREXIN::UCP2 construct have a body weight that is ____________ the weight of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have a body temperature that is _____________ the temperature of wild type animals.the temperature of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have an activity level that is ____________ the activity level of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have a food intake level that is ____________ the food intake of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have a life span that is ______________ the life span of wild type animals.

Answers

The body weight of mice created using the OREXIN::UCP2 construct is higher than that of animals of the wild type.

Weight is a calculation of the gravitational force on an object. It not only depends on the object's bulk but more on the allure district. Therefore, pressure is indeed a measure of force. In the United States, most population measure pressure in pounds.

Keeping your weight in the usual range is a fundamental part of healthful becoming older. As in additional stages of growth, raised body mass index (BMI) in earlier men can increase the possibility of expanding well-being questions. These contain coronary thrombosis, extreme ancestry pressure, stroke, and diabetes.

To know more about weight refer to: https://brainly.com/question/1658757

#SPJ4

magnesium reacts with oxygen to produce magnesium oxide calculate the percentage mass of magnesium in magnesium oxide relative atomic mass mg= 24 relative formula mass mgO=40

Answers

Answer:

24÷40×100%=60%

Explanation:

divide atomic mass by relative mass the multiply by 100%

Which natural methods remove CO2 from the atmosphere

Answers

photosynthesis removes carbon dioxide naturally — and trees are especially good at storing carbon removed from the atmosphere by photosynthesis.

How can the organization of cells, tissues, organs, and organ systems in a multicellular organism be sequenced?

Answers

The level of organization in a multicellular organism begins with the individual cells. These individual cells form a tissue, and the tissues make up an organ. A group of organs forms an organ system, and in turn, these organ systems make up an organism.

What is an organism?

An organism is any living entity that is capable of carrying out essential life functions such as metabolism, growth, reproduction, and adaptation to its environment. Organisms can be single-celled or multi-celled, and they can be classified into different kingdoms, including bacteria, archaea, protists, fungi, plants, and animals. Each organism has unique characteristics that enable it to thrive in its particular environment. These characteristics can be genetic, physiological, anatomical, or behavioral. Organisms are important components of ecosystems, playing critical roles in maintaining the balance of natural systems and contributing to biodiversity.

To know more about organism, click the link given below:

https://brainly.com/question/12825206

#SPJ1

The organization of cells, tissues, organs, and organ systems in a multicellular organism can be sequenced using a combination of histology, imaging, molecular biology, developmental biology, and systems biology techniques.

What is organization of cells?

Organization of cells refers to the arrangement and structure of cells within an organism, which allows them to perform specific functions. In multicellular organisms, cells are organized into tissues, organs, and organ systems, each with a particular function and structure that contributes to the overall function of the organism. The organization of cells is essential for the proper functioning of the organism, as it allows for the coordination of different processes and the maintenance of homeostasis.

The organization of cells, tissues, organs, and organ systems in a multicellular organism can be sequenced using a variety of techniques. Here are some common approaches:

1. Histology: Histology studies the microscopic anatomy of cells and tissues. It involves the preparation of tissue sections, staining, and examination under a microscope. Histology can help to identify the different types of cells, tissues, and organs present in an organism.

2. Imaging: Imaging techniques such as X-ray, CT scan, MRI, ultrasound, and PET scan can provide a non-invasive way to visualize the internal structures of an organism. These techniques can be used to study the morphology and function of organs and organ systems.

3. Molecular biology: Molecular biology techniques such as PCR, DNA sequencing, and gene expression analysis can be used to study the molecular basis of cellular and tissue organization. These techniques can be used to identify the genes and proteins involved in the development and maintenance of different organs and tissues.

Therefore, a combination of these techniques can sequence the organization of cells, tissues, organs, and organ systems in a multicellular organism.

To learn more about the organization of cells click here

https://brainly.com/question/28542920

#SPJ1

a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? mrna splicing formation of new transcription factors dna replication rate translation rate

Answers

A single-stranded RNA genome from a recently discovered virus is used as mRNA after infection. The translation rate method is the one that should be used to study how this virus replicates in a host cell. The correct answer is option(c).

The genome is the whole set of DNA demands in the direction of a container. In persons, the genome resides of 23 pairs of chromosomes situated in the container's core, in addition to a limited chromosome in the container's mitochondria. A genome holds all the new wanted for an individual to expand and function.

The rate of DNA translation changes contingent upon the type of creature. Prokaryotes can turn DNA at 21 amino acids per second, while eukaryotes interpret at a rate of 9 amino acids per second. It was found that the following visage was equated accompanying translation rate: codon habit commonness, few gene knowledge advancement scores, number of RNA binding proteins popular to bind allure mRNA amount, systematize series distance, protein affluence, and 5′UTR free strength.

To know more about genome refer to: https://brainly.com/question/29598514

#SPJ4

The complete question is:

A newly identified virus has a single-stranded RNA genome that is used as mRNA after infection. Its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. Which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell?

A) DNA replication rate

B) mRNA splicing

C) translation rate

D) formation of new transcription factors

What is true about scientific theories?

Answers

Scientific theories are testable. New evidence should be compatible with a theory.

Which of the following is true when talking about scientific theories?

Scientific theories are conclusive. New evidence should be compatible with a theory. If it isn't, the theory is pure or rejected. The longer the central elements of a theory hold—the more inspection it predicts. A scientific theory is a structure suggested by these laws and is conceived to explain them in a scientifically rational manner.

A scientific theory is a broad explanation for things that are widely accepted as true. To become a theory, Scientific theories all have normal characteristics which differentiate them from unscientific ideas like hope and pseudoscience. Scientific theories must be: consistent, parsimonious, capable, empirically testable/verifiable, useful, and progressive.

So we can conclude that a scientific theory can never be proven as truth Scientific theories can be show. The video Player is loading.

Learn more about scientific theories here: https://brainly.com/question/1851175

#SPJ1

which of the following best predicts the effect of inserting this gene into the dna of a bacterial cell?

Answers

The expression of a gene, which results in the creation of a protein or other product encoded by the gene, can be induced by inserting a gene into the DNA of a bacterial cell.

Depending on how this protein or product performs, the cell may then be affected. The new gene would be inserted into the DNA sequence. The sequence would be altered specifically according to the gene and the intended position. The DNA sequence would be cut at that spot and the new gene would be spliced into it, for instance, if the gene had to be placed at a certain site in the DNA. As single-celled prokaryotic organisms, bacteria cells lack a nucleus and other organelles. They have a cell wall that aids in cellular protection and a cell membrane that controls what enters and exits the cell.

To know more about DNA refer to the link below :

brainly.com/question/264225

#SPJ4

professor marcus is studying gene expression in the liver cells of a mouse. she observes that when a steroid hormone enters the liver cells, the cells begin producing a wide variety of new proteins. which of the following statements is the most useful to include in an explanation of this observation?

Answers

The most useful statement to include in an explanation of Professor Marcus's observation is that steroid hormones can activate gene expression by binding to specific receptors in the liver cells, leading to the initiation of a series of molecular events that ultimately result in the production of new proteins.

This highlights the role of hormones in regulating gene expression, and the complex mechanisms by which they control cellular processes. It also emphasizes the importance of studying gene expression in understanding cellular and physiological processes.

The translation of messenger RNA (mRNA) into proteins is known to be modulated by steroid hormones, which include, among others, progestogen, oestrogen, glucocorticoid, and androgen.

It has been demonstrated that sex steroid hormones in mammals influence the expression of important genes, such as the prolactin gene needed for milk production.

To learn more about steroid hormones

https://brainly.com/question/29382368

#SPJ4

Problem 7. A population, obeying the logistic equation, begins with 1000 bacteria, then doubles itself in 10 hours. The population is observed eventually to stabilize at 20,000 bacteria (i.e. the carrying capacity K = 20,000). Find the number of bacteria present after 25 hours and the time it takes the population to reach one-half of its carrying capacity.

Answers

The population of bacteria in 25hrs reach 5084 bacteris. The population  of bacteria reach 1.5 takes t (time) = 26.13 hrs to reach one-half of its carrying capacity.

A. For t = 25hrs,

P (25) = 20000 / (1+19 e^ (-2.5) ln (19 / 9)) = 5083.75

After 25 hrs, the population is 5084 Bacteria.

B. Find the time it takes to reach 1.5 of the carrying capacity.

=> (1.5) x (20,000) = 30,000 and

Recall: P(t) = 20000 / (1+19 e^ (- 2.5) ln (19 / 9) t)

Solve 30,000 = 20000 / (1+19 e^ (- 2.5) ln (19 / 9) t)        for t

=> 30,000 x (1+19 e^ (- 2.5) ln (19 / 9) t) = 20,000

=> 1+19 e^ (- 2.5) ln (19 / 9) t = 3/2

=> 19 e^ (- 2.5) ln (19 / 9) t = 1.5

=> e^ (- 2.5) ln (19 / 9) t = 1.5 / 19

Taking log both sides, we get

=> (- 2.5) ln (19 / 9) t = ln (1.5 / 19)

=> t = 26.1369 hrs  (Rounded to 4 decimal place)

It takes 26.13 hrs for the population to reach 1.5 its carrying capacity.

Bacteria are single-celled microorganisms that are found in virtually every environment on Earth. They play a vital role in the ecosystem, serving as decomposers, fixing nitrogen, producing antibiotics, and forming symbiotic relationships with other organisms. Bacteria are classified into two main groups, Gram-positive and Gram-negative, based on their cell wall structure. They can be found in soil, water, air, and in and on the human body.

Some bacteria can cause infections in humans, such as Staphylococcus aureus and Escherichia coli, while others are beneficial, such as those found in the gut which aid in digestion. Bacteria can be cultured in the laboratory for study and can also be engineered for industrial and agricultural applications. However, their ability to rapidly multiply and evolve can lead to the development of antibiotic-resistant strains, making it important to maintain proper hygiene and use antibiotics wisely.

To learn more about Bacteria visit here:

brainly.com/question/14314349

#SPJ4

fill in the blank.. scott and darpa are siblings who have the same parents. scott has heavy, straight eyebrows, whereas darpa has thinner, arched eyebrows. these differences in eyebrow shape are due to different___that each sibling received from their parents.

Answers

Option B is Correct. Each sibling inherited a different allele from their parents, which is the cause of these variations in brow shape.

The parents of Scott and Darpa are siblings. Darpa's eyebrows are smaller and arched, while Scott's are thick and straight.  A DNA sequence (a single base or a segment of bases) at a certain genomic region might have two or more variations, each of which is referred to as an allele. For any chromosomal region where such variation exists, a person inherits two alleles, one from each parent.

The person has homozygosity for that allele if the two alleles are identical. These various gene variants are referred to as alleles. A cytosine base-coding allele, for instance, may be one of two alleles present at a given locus.

Learn more about alleles Visit: brainly.com/question/23516288

#SPJ4

Correct Question:

Scott and Darpa are siblings who have the same parents. Scott has heavy, straight eyebrows, whereas Darpa has thinner, arched eyebrows. These differences in eyebrow shape are due to different _____ that each sibling received from their parents.

A) nurture

B) alleles

C) gender

D) advice

Option B is Correct. Each sibling inherited a different allele from their parents, which is the cause of these variations in brow shape.

The parents of Scott and Darpa are siblings. Darpa's eyebrows are smaller and arched, while Scott's are thick and straight.  A DNA sequence (a single base or a segment of bases) at a certain genomic region might have two or more variations, each of which is referred to as an allele. For any chromosomal region where such variation exists, a person inherits two alleles, one from each parent.

The person has homozygosity for that allele if the two alleles are identical. These various gene variants are referred to as alleles. A cytosine base-coding allele, for instance, may be one of two alleles present at a given locus.

To learn more about allele visit:

https://brainly.com/question/30507591

#SPJ4

fill in the blank. ___ his studies of ice-polished rocks in his alpine homeland, far outside the range of present-day glaciers, led louis agassiz in 1837 to propose the concept of an age in which great ice sheets had existed in now currently temperate areas.

Answers

In areas that are now temperate in 1837 as a result of his statistical investigations of ice-polished rocks in his native alpine region, which is outside the current glacier range.

Show timer hidden Louis Agassiz proposed the idea of a period in which massive ice sheets had existed. Show timer statistics are hidden. Louis Agassiz proposed the idea of a period in which massive ice sheets had existed in areas that are now temperate in 1837 as a result of his research on ice-polished rocks in his Alpine homeland, well outside the range of modern glaciers.

The Antarctic ice sheet and the Greenland ice sheet are the only ice sheets left in existence today. However, during the most recent glacial epoch, ice sheets completely surrounded much of the planet.

Learn more about homeland Visit: brainly.com/question/16504850

#SPJ4

a species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. which of the following will be true of this species' response to natural selection?

Answers

Option A, A species that has evolved an asexual mode of reproduction by having unfertilized eggs will likely have a slower response to natural selection compared to sexually reproducing species.

Asexual reproduction does not involve the exchange of genetic material through sexual recombination. As a result species, asexual populations tend to have less genetic diversity, which can make it more difficult for the population to adapt to changes in the natural selection environment. In sexually reproducing species, new combinations of genes can arise through sexual recombination, providing a greater pool of genetic diversity that can be acted upon by natural selection. This can allow sexually reproducing species to more rapidly evolve in response to environmental changes.

Learn more about natural selection here:

https://brainly.com/question/23929271

#SPJ4

The complete Question is:

A species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. Which of the following will be true of this species' response to natural selection?

(a)-There will be less genetic variation from recombination and a risk of not adapting quickly to environmental change.

(b)-The species will increase in numbers because genetic variation is increased.

(c)-There will be fewer deaths from natural selection because sexual recombination always leads to extinction.

(d)-There will be more deaths from natural selection because there is no mutation.

(e)-The species will compensate for loss of genetic variation by hybridizing with other species.

create an analogy that compares how a cell manufactures protein to how a factory manufactures a product (ex: candy). be sure the following are represented: protein, amino acid, gene (dna), mrna, trna, ribosome, and the process of transcription and translation.

Answers

Simply said, proteins are the cell's main structural component. They carry out all necessary tasks. protein can:

Serve as enzymes and hasten chemical reactions.

The cytoskeleton, hair, and fingernails serve as the body's structural framework. Transport materials throughout the body and in and out of the cell. Help your muscles to contract.

In other words, your body or the cells would not function without proteins.Consider building a house as a means to comprehend how proteins are created. The key players in protein synthesis will be covered in this course, along with how they cooperate to create the protein home.

To know more about proteins click here:

brainly.com/question/29776206

#SPJ4

match the important points regarding selection of an appropriate germicide with the description/rationale that fits it best:
1. toxicity
2. cost and availability
3. activity in presence of organic matter
4. storage and stability
5. compatibility
A. all germicides are somewhat harmful to humans and the environment. this parameter identifies HOW harmful the chemical is
B. some germicides may become less efficient when used on/in areas with organic matter
C. some germicides are highly effective, but are rare and/or expensive
D. some germicides may lose efficiency over time, or may be required in very large amounts that would make them impractical for frequent applications
E. some substances are negatively affected by treatment with some germicides (i.e. corrosives damaging metals/rubber)

Answers

Some desirable characteristics of your chosen germicide include: - Rapid action even at low doses. - Long-term stability and solubility in water or alcohol. - Broad-spectrum microbicidal activity that is not harmful to human or animal tissues.

Germicide. A chemical agent that kills microorganisms is defined. Disinfectants and antiseptics are two examples. Definition: a chemical agent that kills hazardous germs while remaining selectively poisonous enough to be used on human skin. Germicides are classified into two types: a. Antiseptic: are germicides used on live surfaces? a. Disinfectants: These are often applied to the surface of inanimate objects and kill all pathogenic microorganisms except spores.

1-A

2-C

3-B

4-D

5-E

Learn more about germicide

https://brainly.com/question/13052271

#SPJ4

subliminal processing refers to the way in which consumers can be influenced without their brains sensing exposure to any kind of stimuli. (True or False)

Answers

The term "subliminal processing" describes how customers can be persuaded without their brains registering any exposure to stimuli. false.

A subliminal stimulus is a type of stimulus that, although it may be detected & processed in the brain, does not cause consciousness of perception, according to psychological study. A recipient of the a subliminal stimulus, for example, could be able to sense it but not necessarily be aware of it. The term "subliminal processing" describes how the human brain detects weak stimuli, or stimuli that happen below the threshold of conscious consciousness. Consumer exposure to and awareness to marketing stimuli is the first step in the perceptual process, which concludes with consumer interpretation. Reality and how customers perceive it are frequently extremely different

Learn more about brain

https://brainly.com/question/2664243

#SPJ4

Which one of the following researchers developed a theory of evolution that was very similar to Charles Darwin's?
O Cuvier
O Lyell
O Wallace
O Hutton
O Lamarck

Answers

Wallace's theory of evolution and Charles Darwin's are strikingly similar.

The phrase "theory of evolution by natural selection," first out by Charles Darwin & Alfred Russel Wallace inside the nineteenth century, is more commonly known as the theory of evolution.

Other early ideas like Lamarck, Lyell, & Malthus had an impact on Darwin. Darwin's understanding of artificial selection had an impact as well. Wallace's evolution study supported Darwin's theories. The notion of geologic occurrences has an impact on Darwin's theory of evolution. The theory behind geologic occurrences was put out by Hutton and Lyell. The geological events which have occurred in the past and those that are now occurring all follow a similar set of operational processes.

Learn more about evolution

https://brainly.com/question/6206508

#SPJ4

Dr.Griffin is treating a young couple who are having a child. The parents are worried that since the mo a carrier for the disorder of color blindness that the child will have color blindness as well. The father does not have color blindness. What are the chances that the child will NOT have color blindness? Use X for no color blindness and X for having color blindness
Pls helppp

Answers

The child has a 50% chance of having color blindness (Xc) and a 50% chance of not having color blindness (XX).

What is color blindness?

Color blindness, also known as color vision deficiency, is a condition in which an individual has difficulty seeing certain colors, or a reduced ability to distinguish between certain colors.

The chances of the child NOT having color blindness depend on the genetic makeup of the mother and the father. If the mother is a carrier of the color blindness gene (Xc), she has one normal allele (X) and one mutant allele (c). The father does not have color blindness, so he has two normal alleles (XX).

The chance of the child inheriting the normal allele from the mother is 50%. The chance of the child inheriting the normal allele from the father is 100%. Therefore, the overall chance of the child NOT having color blindness is 50% * 100% = 50%. This means that the child has a 50% chance of having color blindness (Xc) and a 50% chance of not having color blindness (XX).

Learn more about color blindness, here:

https://brainly.com/question/29807811

#SPJ1

Identify whether each of the following would result in the membrane potential becoming more positive or more negative.Match the appropriate change with each scenario. a) Increasing the concentration of K+ in the extracellular fluid. b) Decreasing the concentration of K+ in the extracellular fluid. c) Decreasing the number of leak channels for Na+ along the cellular membrane. d) Inserting more K+ leak channels into the cellular membrane. e) Increasing the concentration of Na+ in the extracellular fluid

Answers

The membrane is considered to be depolarized if the membrane potential shifts from being negative to being positive relative to the resting potential.

The membrane is referred to as being hyperpolarized if its potential is more negative than it is at its resting potential.

At a specific location on the neuron's membrane, hyperpolarization occurs when the membrane potential increases, Depolarization occurs when the membrane potential decreases (more positive).More favorably: There are three times as many Na+ leak channels and twice as much K+ outside of the cell.More detrimental Increase the amount of K+ leak channels while halving the amount of Na+ outside the cellEssentially unchanged Increasing the cell size by two without adding channels two times as many closed channels for K+.

Learn more about resting membrane Visit: brainly.com/question/12885791

#SPJ4

Correct Question:

For each of the following, indicate whether the condition will cause the membrane potential to become more positive, more negative, or largely unchanged when compared to the normal physiological resting membrane potential.

A. Double the size of the cell, without adding channels

B. Double the number of K+ leak channels

C. Triple the number of Na+ leak channels

D. Double the concentration of K+ outside the cell

E. Decrease the concentration of Na+ outside the cell by half

F. Double the number of closed channels for K+

using the plot, which statement explains why metabolism is regulated to keep the ratio [atp]/[adp] high?

Answers

Suppressed mitochondrial function leads to lower production of mitochondrial ATP and hence lower cytosolic ATP/ADP ratios that favor enhanced glycolysis.

Suppressed mitochondrial function leads to lower production of mitochondrial ATP and hence lower cytosolic ATP/ADP ratios that favor enhanced glycolysis. Thus, cytosolic ATP/ADP ratio is a key feature that determines if cell metabolism is predominantly oxidative or glycolytic.

The ATP:ADP ratio is a central control parameter of cellular energy metabolism that determines the free-energy change for ATP hydrolysis and therefore the driving force for many reactions1.

Breaking down glucose releases energy, which is captured by the cell in the form of adenosine triphosphate, or ATP. ATP is a small molecule that gives cells a convenient way to briefly store energy. Once it's made, ATP can be used by other reactions in the cell as an energy source.

The changes in ADP/ATP ratio have been used to differentiate the different modes of cell death and viability. Increased levels of ATP and decreased levels of ADP have been recognized in proliferating cells. In contrast, decreased levels of ATP and increased levels of ADP are recognized in apoptotic cells.

We are a comprehensive global provider of cloud-based human capital management (HCM) solutions that unite HR, payroll, talent, time, tax and benefits administration, and a leader in business outsourcing services, analytics and compliance expertise.

Learn more about glycolysis here:-

https://brainly.com/question/29604117

#SPJ4

which of the following is NOT true of ATP

A.) The hydrolysis of ATP is an exergonic process

B.) Energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, NOT from the phosphate bond itself

C.) ATP has less potential energy than ADP

D.) the release of a phosphate in ATP hydrolysis is often used to do exergonic work of a cell

Answers

The energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, and not from the phosphate bond itself. ADP has less potential energy than ATP. Thus, the correct options are B and C.

What is ATP hydrolysis?

ATP hydrolysis is the catabolic reaction process through which the chemical energy that has been stored in the high-energy phospho-anhydride bonds in the ATP (adenosine triphosphate) is released after the splitting of these bonds, for example in the muscles, by producing work in the form of mechanical energy.

Energy from the hydrolysis of ATP is an exergonic process. This energy from ATP hydrolysis comes from the phosphate bond itself. ADP has less potential energy than ATP.

Therefore, the correct options are B and C.

Learn more about ATP here:

https://brainly.com/question/14637256


#SPJ1

Which of the following is a biotic factor? a) a predator b) a mountain range. c) phosphorus inputs. d) a stream. e) nitrogen inputs.

Answers

The following biotic factor is a predator.

Thus, the correct option is A.

The ecosystem comprises both biotic аnd аbiotic fаctors. The term “biotic” meаns “of or relаted to living orgаnisms”. Аn ecosystem consists of аll living orgаnisms аnd the physicochemicаl components.  Biotic fаctors include аll living orgаnisms present in the environment. It includes plаnts, аnimаls аnd microorgаnisms. А predаtor is аn orgаnism thаt cаptures аnd eаts аnother (the prey). This аct is cаlled predаtion.

In contrаst, the аbiotic components include the environmentаl fаctors like аir, wаter, soil, light, temperаture, mountain range, phosphorus inputs, stream, nitrogen inputs, etc.

For more information about biotic factors refers to the link:

https://brainly.com/question/34710

#SPJ4

which of the following compounds is not hydrophilic? proteins carbohydrates lipids nucleic acids water

Answers

The compound which is not hydrophilic is: lipids.

Hydrophilic refers to the property of a substance that has a strong affinity towards water. The molecules that have the affinity towards water are called hydrophile. The examples of hydrophiles are: carbohydrates, salts, amino acids, etc.

Lipid is an amphipathic molecule that has a hydrophilic head and a hydrophobic tail. It is a fatty acid that has several functions inside the living body. The most important function is in the synthesis of plasma membranes, which is made up of lipid bilayer. The other forms of lipids are: fat-soluble vitamins, monoglycerides, diglycerides, etc.

To know more about hydrophilic, here

brainly.com/question/13378292

#SPJ4

Other Questions
Based on this information, the predetermined overhead rate per direct labor dollar for dept. b is $ ? What sound does the "S" make in this word? AdverseSZ What were impacts of technological changes on the United States during the 1800s which of the following enzymes is associated with conditions affecting skeletal muscles? select one: a. aldolase b. alkaline phosphatase c. gamma-glutamyltransferase d. 5'-nucleotidase which actions by the nurse are appropriate when administering a vaginal cream? select all that apply. help plss all of the following are true of topical anesthetics used in dentistry except one. which one is the exception? group of answer choices lidocaine may contain preservatives such as the parabens that could induce an allergic response. topical anesthetics are possible allergens. benzocaine is a commonly used amide topical anesthetic that can contribute to an allergic reaction. tetracaine can contribute to an allergic response. based on the table, do the data support the use of a normal model to approximate population characteristics? phospholipids provide the cell-specific functions of the plasma membrane. TRUE or FALSE dominick has analyzed the overall attractiveness of doing business with three possible countries and has determined that country a is the best choice based on the potential for huge economic growth that should occur there because of recent advances in technology. which factor of overall attractiveness is dominick basing his decision on? eastside vintage has a net profit margin of 6.2 percent, a payout ratio of 30 percent, an roa of 14.2 percent, and an roe of 18.6 percent. this firm maintains a constant payout ratio and is currently operating at full capacity. what is the maximum rate at which the firm can grow without acquiring any additional external financing? which issue could cause a plant to have too little water? a not enough photosynthesis b not enough photosynthesis c too much transpiration d too much respiration Write a function called min that returns the minimum of the two numbers passed in as parameters in javascript. Why did the framers meet in Philadelphia at the constitutional convention? what is the main purpose of epidemiologic surveillance? evergreen corp. issues 10,000, $1,000 face amount bonds. each bond can be converted into 20 shares of common stock. at the bond issue date, the company's common shares trade for $55 per share. at the date of issue, evergreen should recognize an addition to equity of maria is a cultural anthropologist who wants to better understand the lives of women in coffee farming communities in brazil. what primary research strategy will she likely use to gain a holistic perspective in order to accurately answer her research questions? group of answer choices a rise in a woman's basal body temperature signals group of answer choices that ovulation has occurred. the beginning of the menstrual cycle. that fertilization has occurred. the end of the current menstrual period. Timely Transport provides local delivery service for a number of downtown and suburban businesses. Delivery charges are based on distance and weight involved for each delivery: 22 cents per pound and 17 cents per mile. Also, there is a $27 handling fee per parcel. a. Develop an expression that summarizes delivery charges. (Enter your answers as dollar amounts to 2 decimal places (x1-weight, x2 = distance). Omit the "S" sign in your response.) b. Determine the delivery charge for transporting a 37-pound parcel 17 miles. (Do not round your intermediate calculation. Round your answer to 2 decimal places. Omit the "$" sign in your response.) John Watson was interested in how ____ behavior and BF Skinner focused on how _____ control behavior.