Why shouldn’t Harold godwinson be king

Answers

Answer 1
Uh i don’t know buddy I’m just a helping hand but good luck!

Related Questions

Help ASAP, which one is correct

Answers

Answer:

The answer is both A and B

Explanation:

Because at the end of the war woman’s did get the right to vote and they also got more rights to do things men’s could’ve done and they didnot.

hope this helps:

2. Sketch: Draw a side view of the plate boundary before and after the plate motion. Draw an arrow to
show which way the plate moved.

Answers

Before and after example

What happened to the Ottoman Empire after World War I?
O Its territories were divided under the Treaty of Versailles.
O It became an independent nation.
O It became a modern industrial power.
• Its territories were absorbed by Italy under the Treaty of Versailles.

Answers

Answer:

C.

Explanation: It became the modern Turkey. The last sultan was Ottoman Sultan.

Why was coffee initially controversial at Oxford?

Answers

Answer:

mhm im not sure about this question sowwy!

Answer:

King Charles II stated that coffeehouses “have produced very evil and dangerous effects,” and were also a “disturbance of the peace and quiet realm,”. This edict put an end to the sale of coffee, tea and chocolate in coffeehouses and in homes as well.

Explanation:

Which of these statements would be classified as Communist Russia?

A. The USSR provided land to all citizens.

B. Stalin formed a totalitarian state.

C. The USSR had a free market economy.

D. The Russian Orthodox Church made many governments decisions.

Answers

Answer:

A

Explanation:

⠀⠀⠀⠀⠀⠀⢀⣤⣀⣀⣀⠀⠻⣷⣄

⠀⠀⠀⠀⢀⣴⣿⣿⣿⡿⠋⠀⠀⠀⠹⣿⣦⡀

⠀⠀⢀⣴⣿⣿⣿⣿⣏⠀⠀⠀⠀⠀⠀⢹⣿⣧

⠀⠀⠙⢿⣿⡿⠋⠻⣿⣿⣦⡀⠀⠀⠀⢸⣿⣿⡆

⠀⠀⠀⠀⠉⠀⠀⠀⠈⠻⣿⣿⣦⡀⠀⢸⣿⣿⡇

⠀⠀⠀⠀⢀⣀⣄⡀⠀⠀⠈⠻⣿⣿⣶⣿⣿⣿⠁

⠀⠀⠀⣠⣿⣿⢿⣿⣶⣶⣶⣶⣾⣿⣿⣿⣿⡁

⢠⣶⣿⣿⠋⠀⠀⠉⠛⠿⠿⠿⠿⠿⠛⠻⣿⣿⣦⡀

⣿⣿⠟⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠈⠻⣿⡿

Read a quotation by New York Senator William Marcy.
To the victor belong the spoils of the enemy.
Based on this quotation, William Marcy could best be described as
O a Jackson historian.
O a Jackson rival:
a Jackson opponent.
O a Jackson supporter.

Answers

Answer:

a Jackson supporter.

Explanation:

This statement shows that William Marcy was a supporter of Andrew Jackson's policies. Spoils in this context means earned benefits as Andrew Jackson rewarded his supporters with government jobs. Marcy was actually defending one of Jackson's appointments when he made this statement.

So marcy is obviously a supporter because he is obviously trying to say that those who supported Andrew Jackson should be the ones to benefit from his administration.

Answer:

D. A Jackson Supporter

Explanation:

William marcy was a "jackson supporter"

have a good day <3

1896-1920 How did Americans change over this period of
time? How were American the same?

Answers

Answer:

The history of the United States from 1865 until 1918 covers the Reconstruction Era, the Gilded Age, and the Progressive Era, and includes the rise of industrialization and the resulting surge of immigration in the United States. This article focuses on political, economic, and diplomatic history.

This period of rapid economic growth and soaring prosperity in the North and the West (but not in the South) saw the U.S. become the world's dominant economic, industrial, and agricultural power. The average annual income (after inflation) of non-farm workers grew by 75% from 1865 to 1900, and then grew another 33% by 1918.[1]

With a decisive victory in 1865 over Southern secessionists in the Civil War, the United States became a united and powerful nation with a strong national government. Reconstruction brought the end of legalized slavery plus citizenship for the former slaves, but their new-found political power was rolled back within a decade, and they became second-class citizens under a "Jim Crow" system of deeply pervasive segregation that would stand for the next 80–90 years. Politically, during the Third Party System and Fourth Party System the nation was mostly dominated by Republicans (except for two Democratic presidents). After 1900 and the assassination of President William McKinley, the Progressive Era brought political, business, and social reforms (e.g., new roles for and government expansion of education, higher status for women, a curtailment of corporate excesses, and modernization of many areas of government and society). The Progressives worked through new middle-class organizations to fight against the corruption and behind-the-scenes power of entrenched, state political party organizations and big-city "machines"

Explanation:

Pick witch part u want hope it helps

Which of the following was NOT a reason the US went to war with Spain?
A. gain access to raw materials like sugar
B. establish new places to sell goods
C. the sinking of the Lusitania
D. help the Cuban people escape harsh treatment by the Spanish

Answers

The answer I believe is B

What I do know is, war was declared because they wanted to help the cubans gain their independence from spain and their ship mysteriously sunk.

Hope this helps!

How is The Dominican Republic independence significant to history?

Answers

Dominican Republic declares independence as a sovereign state. ... Though Haiti had been only the second European colony in the Americas to achieve independence, and its revolution constituted one of the largest and most important slave revolts in all of history, Dominica suffered under Haitian rule.

What were the important effects of the tactics adopted by the united states ground forces in vietnam

Answers

Explanation:

United States of America launched war in 1965, in North Vietnam. The United States of America, mainly their ground forces adopted the tactics by the acronym BEAST  in their war against Vietnam.

B meant Bombing- Air raids were conducted in Vietnam's capital Hanoi to bomb the city.

E meant Escalation- The american President gradually escalated the number of soldiers deployed in Vietnam

A meant Air and Artillery - Americans attacked using air and major artillery

S meant Search- US army led itself in vast forests in order to find the enemy

T meant Technology- American army used topmost war technology in the war

How does art reflect the ideas and events of the Age of Enlightenment and the Democratic Revolutions in the period 1750-1900?

Answers

Answer:

...... ........ ........

The Enlightenment encouraged criticism of the corruption of the monarchy (at this point King Louis XVI), and the aristocracy. Enlightenment thinkers condemned Rococo art for being immoral and indecent, and called for a new kind of art that would be moral instead of immoral, and teach people right and wrong.

Do you think stability in the Middle East is important to U.S. interests? Why or why not?

Answers

Answer:

Stability with the Middle East is important to the U.S interests because the Middle East is the most important source of energy, producing almost 40% of the world's oil.

Stability in the Middle East is important to U.S. interests because Middle East is rich in natural resources, especially in oil production.

What is Middle East?

The Middle East is a geopolitical term that refers to the regions of Arabia, Asia Minor, East Thrace, Egypt, Iran, the Levant, Mesopotamia, and the Socotra Archipelago. the term "Middle East" is came into existence as the replacement of the term "Near East"  in early 20th century.

Middle East is rich in oil production and it's export, which contributes to the entire region through the wealth it generates and the labor utilization.

The unresolved conflict between Israelis and Palestinians is one of the reason behind the conflict in the whole region of Middle East.

Hence, The richness of resources is the reason behind US interest.

To learn more about Middle East, here

https://brainly.com/question/12457044

#SPJ2

Identify ONE argument in favor of imperialism and ONE argument against imperialism from yesterday's primary source documents.

Answers

Answer:

ion think they are an argument

Explanation:

because i research this and couldn't find nun

Answer:

I swear if you don’t STOP SPAMMING ON PEOPLES QUESTIONS

Explanation:

5. How might the need for oil affect American foreign policy?

Answers

Answer:

America's oil and natural gas industry supports 10.3 million jobs in the United States and nearly 8 percent of our nation's Gross Domestic Product we spur economic growth through hundreds of billions of dollars investing right here at home every year.

I hope this is your answer.

why did the native americans want war in the war of 1812

Answers

Answer:

For Native Americans, the War of 1812 was a desperate struggle for freedom and independence. Native Americans became involved in the conflict to secure British support for their own war against the United States. Led by Tecumseh, they played a key role in defending Canada.

Answer:

They wanted to keep there land safe, safeguard their tribal lands. They hoped that if the British would get a victory that it would relieve the

unrelenting pressure they were experiencing from U.S. settlers who wanted to move further in the native amaricans land.

what would happen if earth did not have any greenhouse gases?​

Answers

I think that the heat will not be able to maintain itself  enough and the cold gases of the space could freeze earth and we would not be alive.

Hope this helps

Answer: It would be exactly like it is now, because the greenhouse effect is a fake physics hoax, pretending that the atmosphere can reheat the Earth’s surface with its own heat in violation of Nature’s ironclad Second Law of Thermodynamics. Those who claim that it only traps surface heat in the atmosphere are missing the boat, namely, that the atmosphere contains solar heat removed from the surface, which is on its way toward space and can never return, anymore than heat from a fireplace can go back down the chimney and cook the meal twice. Look at an a-bomb blast and its mushroom cloud. That’s where the heat from the blast went, namely, up toward space, leaving a cooled surface. Therefore the CO2 global warming theory can only hold water if there’s a physical mechanism for atmospheric CO2 to send heat back down to the surface via radiation alone.

The leftist environmentalists have long been claiming suck, er, such a mechanism, CO2 back radiation. According to them, atmospheric CO2 absorbs surface heat then reradiates it back at so many watts per square meter, increasing surface temperatures by so many degrees C, with higher concentrations in the far future allegedly threatening runaway global warming. Their solution is to dismantle the entire fossil fuel industry now via mass government action and taxation and prepare the world for global Marxism, which they wanted all along.

Hope this helps have a nice day❤️

Explanation:

Without the greenhouse effect, the Earth would have an average temperature of -18 °C and be covered in ice. Life as we know it would not be able to survive. ... By burning fossil fuels and cutting down trees, we are releasing more and more carbon dioxide into the atmosphere, and that has caused temperatures to rise.

SOMEBODY HELP PLEASEEE I DONT KNOW WHY THIS IS SUPPOSED TO BE 20+ CHARACTERS LONG BUT HERE IT IS

Answers

Answer:

20h + 20

Explanation:

5 x 2h=10h

5 x 4 = 20

10h + 20 + 10h = 20h + 20

HELP ME PLEASEEEEEEE

The Code of Hammurabi (1772 BC) includes laws focusing on contracts. What type of U.S. law is based on the Code of Hammurabi?


A. Civil

B. Criminal

C. Constitutional

D. Military

Answers

Answer:

The code of Hammurabi states an eye for an eye and a tooth for a tooth.

Explanation:

So based on this we could say that the type of law this inspired is civil law

I think the answer is A. Civil.

According to the Article, what caused an economic crisis in Egypt?
A Civil wars split the empire apart and much of its gold disappeared.
B
Mansa Musa flooded parts of Africa with gold and its value plummeted.
с
New Mali leaders taxed all of the trade that took place in the empire.
D
Mansa Musa took control of Mali and most of the world's gold and salt.

Answers

The answer is c I think but I’m not so sure sorry

In what ways did the British change their policies as a result of the rebellion of 1857?

Answers

Explanation:

policies were made to protect landlords and zamindars and give them the security of rights to their lands.

British decided to respect the customary requirements and social practises if people in India.

Compare and contrast the South,West and central Asia in terms of their attire, Accessories/crafts, architectures or sculptures.​

Answers

Answer:

yyyy

Explanation:

Does someone know this one please I need help?

Answers

Answer:

the 2 one

Explanation:

Number 2 Good Luck!!!!

help fasttttttttttttttttttttt

Answers

Answer:

b, b, a, d, A

Explanation:

i imight be wrong but here you go

which letter is pointing to the country that is classified as federal form of government

Need ASAP

Answers

Answer:

B I think

Explanation:

How did the United States win the war in the Pacific?​

Answers

Answer:

American forces attacked the Japanese in the Soloman Islands, forcing a costly withdrawal of Japanese forces from the Island of Guadalcanal in February 1943

What advantages did American-built Sherman tanks have over German panzers?

Answers

The Sherman burns less gas and oil and as a result is able to go much farther on a tank full of gasoline.

Answer: Numbers

Explanation: The Sherman tank might not have have had the best armor or gun but they were mass produced and it gave them a number advantage

Read the passage.
Based on the information provided, what visual
information would be most helpful to include with the
passage?
The moon is one-fourth the size of Earth, and the
moon's gravity is about one-sixth of Earth's. Less
gravity and no atmosphere means that objects travel
farther when thrown on the moon.
O
a chart comparing the sizes of the moon and the
Earth
O a diagram showing how gravity affects the path of a
thrown object
O a photograph of a child throwing a ball for a dog to
catch
O a graph comparing distances traveled by objects
thrown on Earth and the moon
Mark this and return
Save and Exit
Neyt

Answers

Answer:

a

Explanation:

because

Answer:

a

Explanation:

In the 1800s, the notion of manifest destiny was the belief that










Who did the United States fight in World War II?

Answers

Answer:

On December 7, 1941, the U.S. was thrust into World War II when Japan launched a surprise attack on the American naval fleet at Pearl Harbor. The following day, America and Great Britain declared war on Japan. On December 10, Germany and Italy declared war on the U.S

Explanation:

Manifest destiny a phrase coined in 1845 is the idea that United States is destined—by God,it’s advocates believed—to expand its dominion and spread democracy and capitalism across the entire North America continent
Hope this Helps :)

Can someone please help!!! I will mark brainliest!!!!

Answers

it’s a blank image sorry

How did Rerum Novarum affect the Catholic Church? Was it positive or negative? And does it still affect us today?

Answers

Answer:

The answer is below

Explanation:

Rerum Novarum is an open letter written and distributed by Pope Leo XIII in 1891.

It has various effects on the Catholic Church, some of which are:

1. It encouraged the church to assist the poor and vulnerable people.

2. It established the idea that Church can speak out on social matters.

The effects of Rerum Novarum were positive. Some of which are:

1. It promotes work satisfaction

2. It promotes cooperation among different classes.

The effect of Rerum Novarum still affects us today as Churches continue to speak on social matters and encourage a good sociopolitical economy that benefits everybody regardless of classes.

Other Questions
Fill in the blank in the following sentence with "en" or "Y"as appropriate.J___ vais.yen b(1)= -12b(n)=b(n1)4Find the 3rd term of the sequence. Show me the solutions and calculations. un debate sobre temas controversiales como lalegalizacin de las drogas, la homosexualidad, la eutanasia y lamigracin. Toma en cuenta estructura. 7. Find the inverse of f(x) = -2x + 10. Please show work. Which is NOT a type of crowd?ConventionalO FormativeO CasualO Expressive A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-