true/false. the breeding of animals and in the cultivation of plants by which the breeder chooses to perpetuate only those forms having certain desirable inheritable characteristics.

Answers

Answer 1

True. This is a form of artificial selection, which is a process in the breeding of animals and in the cultivation of plants by which the breeder chooses to perpetuate only those forms having certain desirable inheritable characteristics.

The breeding of animals and in the cultivation of plants by which the breeder chooses to perpetuate only those forms having certain desirable inheritable characteristics is a process known as artificial selection. Artificial selection is the intentional selection of desired traits in plants and animals by humans, typically for agricultural purposes. It involves breeding organisms with desirable traits in order to produce offspring with those traits. This can be done by selecting animals or plants with the desired traits for breeding, or by selectively breeding animals or plants for generations to ensure the desired traits are passed on. Artificial selection can also involve genetic engineering, which involves introducing desired traits into organisms by manipulating their genes.

To know more about breeding please refer:

https://brainly.com/question/508892

#SPJ4


Related Questions

the structure indicated by the letter e controls equilibrium by receiving sensory information from all the following areas except the

Answers

By receiving sensory data from every Oculomotor nerve, the structure denoted by the letter "e" regulates equilibrium.

The third cranial nerve, or oculomotor nerve (CN III), is one instance where the name clearly identifies the nerve's purpose (oculo = relating to the eye, motor = creating movement). Therefore, it is clear just by looking at the name that the oculomotor nerve will innervate muscles that move either the entire eye or specific parts of the eye. The nerve's ability to produce movement is what makes it a useful sign of brain damage.

All cranial nerves with motor capabilities will have their nuclei in either the brainstem or spinal cord as their place of origin (medulla, pons, or midbrain).

know more about cranial nerves here

https://brainly.com/question/30431228#

#SPJ4

Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color, and find that 68% answered Brown. 1. What is the population? all people in the country [ Select] 2. What is the sample? [Se all people in the country 2500 people all people who use hair color 3. What is the variable here? [ Select] 4. List possible data values. [Select ] 5. The parameter of interest is [Select ] > 6. The statistic computed is [Select ]

Answers

The term "population" refers to all citizens who are either permanently residing in a country or who are just passing through.

This indicator reveals how many people typically reside in a certain location. Growth rates are indeed the population changes that occur each year as a result of births, deaths, and net migration. Changing the colour of one's hair is known as "hair colouring" or "hair dyeing." The primary explanations for this are aesthetic: restore the original hair colour after it has been faded by hairstyling procedures or sun bleaching, hide grey or white hair, or alter to a hue seen to be more trendy or attractive. Population refers to the total amount of people residing in a specific location at any one moment.

(Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color. Identify the population a. people who color their hair b.all women call individuals in the country d. all adult males in the country)

Learn more about population

https://brainly.com/question/21654221

#SPJ4

Leukocytes displaying red cytoplasmic granules when treated with Wright's stain are most likely ________.
A. basophils
B. erythrocytes
C. eosinophils
D. monocytes

Answers

Leukocytes displaying red cytoplasmic granules when treated with Wright's stain are most likely eosinophils (C)

Eosinophils are a type of white blood cell that helps the body fight against infections. This situation almost always points to either an infection caused by a parasite, an allergic reaction, or malignancy. Blood eosinophilia refers to an abnormally high number of eosinophils in the blood, while excessive levels of eosinophils in the tissues at the site of an infection or inflammation are known as tissue eosinophilia.

Eosinophils are often the largest type of granulocyte that can be seen in healthy blood. The cytoplasm of these organisms is often colorless or a light blue. On the other hand, the big granules that are present almost always serve to conceal the hue. Because they have absorbed the acidic components of the Wright stain, these granules have taken on a reddish orange color.

To learn more about eosinophils, click here:

https://brainly.com/question/10688608

#SPJ4

in the following list, choose all that are considered complex tissues. multiple select question. xylem periderm sclerenchyma phloem epidermis parenchyma

Answers

According to the given lists xylem, phloem, and periderm are considered complex tissues.

Complex tissues are containing various types of cells, that is asserted. These tissues function as administering tissues as well as various types of cells agree as a part. These tissues are also known as vascular tissues as the correct vascular bundles. It is a somewhat fabric that is to say containing in addition to individual types of cells, and so forth the cells coordinate to act an average function. It resides in parenchyma and sclerenchyma cells. The names of a few complex tissues are the xylem and phloem.

The xylem and phloem are famous as complex tissues as they are containing as well individual types of cells. The complex fabric present in the xylem and phloem is vascular fabric. It is an attending fabric. Its main function searches to conduct or transport fluid and vitamins from individual parts to other parts of the plant.

To know more about xylem refer to: https://brainly.com/question/14197052

#SPJ4

If a cell does not need a particular protein at a given time, which of the following strategies will require use of the least energy/resources (be the most energy/resource efficient) compared to the others? (Choose the ONE best answer)

Answers

Do not transcribe the mRNA from the gene encoding this protein.

A pre-mRNA molecule is created during transcription by the enzyme RNA polymerase II, which is then processed to create mature mRNA. A gene's DNA acts as a model for complementary base pairing.

If a gene is not transcribed in a cell, it cannot be used to make a protein there. A gene's transcription will almost certainly result in the production of a protein (expressed). The more a gene is transcribed, the more protein will typically be produced.

Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the information necessary for protein synthesis.

Learn more about " mRNA " to visit here;

https://brainly.com/question/12903143

#SPJ4

FILL IN THE BLANK within hours after conception, the first 23 pairs of chromosomes within the zygote ______, forming two complete sets of the genome.

Answers

Within hours after conception, the first 23 pairs of chromosomes within the zygote duplicate, forming two complete sets of the genome.

This process is called DNA replication, and it ensures that each daughter cell will receive a full chromosomes of genetic information. During replication, the DNA molecule unzips, and each strand serves as a template for the synthesis of a new zygote complementary strand. This is chromosomes by the addition of nucleotides, the building blocks of DNA, by the enzyme DNA polymerase. The process of replication is semi-conservative, zygote meaning that each daughter cell will receive one old strand and one new strand. This duplication of genetic information is essential for the proper development of the zygote into a viable organism, as it allows for the chromosomes of cells with identical genetic material, which can then differentiate and specialize to perform specific functions.

Learn more about zygote here:

https://brainly.com/question/26087722

#SPJ4

the theory that mitochondria and plastids originated from prokaryotic cells engulfed by a host cell is

Answers

The theory that mitochondria and plastids originated from prokaryotic cells engulfed by a host cell is known as: endosymbiotic theory.

Prokaryotic cells the primitive type of cells that do not have a well-defined nucleus. Instead they have a nucleus like structure called nucleoid. The genetic material lies openly as an aggregate on the cytoplasm and is also devoid of any cell organelles.

Mitochondria is the double membranous cell organelle of eukaryotes. The inner membrane is folded into various finger-like projections called cristae that increase the surface area of the organelle. The function of mitochondria is to synthesize ATP for the body requirements.

To know more about prokaryotic cells, here

brainly.com/question/18348786

#SPJ4

a species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. which of the following will be true of this species' response to natural selection?

Answers

Option A, A species that has evolved an asexual mode of reproduction by having unfertilized eggs will likely have a slower response to natural selection compared to sexually reproducing species.

Asexual reproduction does not involve the exchange of genetic material through sexual recombination. As a result species, asexual populations tend to have less genetic diversity, which can make it more difficult for the population to adapt to changes in the natural selection environment. In sexually reproducing species, new combinations of genes can arise through sexual recombination, providing a greater pool of genetic diversity that can be acted upon by natural selection. This can allow sexually reproducing species to more rapidly evolve in response to environmental changes.

Learn more about natural selection here:

https://brainly.com/question/23929271

#SPJ4

The complete Question is:

A species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. Which of the following will be true of this species' response to natural selection?

(a)-There will be less genetic variation from recombination and a risk of not adapting quickly to environmental change.

(b)-The species will increase in numbers because genetic variation is increased.

(c)-There will be fewer deaths from natural selection because sexual recombination always leads to extinction.

(d)-There will be more deaths from natural selection because there is no mutation.

(e)-The species will compensate for loss of genetic variation by hybridizing with other species.

which of the following is NOT true of ATP

A.) The hydrolysis of ATP is an exergonic process

B.) Energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, NOT from the phosphate bond itself

C.) ATP has less potential energy than ADP

D.) the release of a phosphate in ATP hydrolysis is often used to do exergonic work of a cell

Answers

The energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, and not from the phosphate bond itself. ADP has less potential energy than ATP. Thus, the correct options are B and C.

What is ATP hydrolysis?

ATP hydrolysis is the catabolic reaction process through which the chemical energy that has been stored in the high-energy phospho-anhydride bonds in the ATP (adenosine triphosphate) is released after the splitting of these bonds, for example in the muscles, by producing work in the form of mechanical energy.

Energy from the hydrolysis of ATP is an exergonic process. This energy from ATP hydrolysis comes from the phosphate bond itself. ADP has less potential energy than ATP.

Therefore, the correct options are B and C.

Learn more about ATP here:

https://brainly.com/question/14637256


#SPJ1

magnesium reacts with oxygen to produce magnesium oxide calculate the percentage mass of magnesium in magnesium oxide relative atomic mass mg= 24 relative formula mass mgO=40

Answers

Answer:

24÷40×100%=60%

Explanation:

divide atomic mass by relative mass the multiply by 100%

introduction of iron and functions of iron in the human body

Answers

Iron is an essential mineral that plays an important role in many of the body's functions. Here is a brief introduction to iron and its functions in the human body:

Introduction:
Iron is a metallic element that is found in many foods, including red meat, poultry, seafood, beans, lentils, fortified cereals, and some fruits and vegetables. It is also available in supplement form. The human body needs iron to produce hemoglobin, a protein in red blood cells that carries oxygen from the lungs to the rest of the body.

Functions:

Oxygen Transport: Iron is a crucial component of hemoglobin, which helps to transport oxygen from the lungs to the rest of the body.
Energy Production: Iron is involved in energy production, helping to create ATP (adenosine triphosphate), the body's primary energy source.
Immune System Function: Iron is also important for a healthy immune system, as it helps to produce white blood cells that fight infection.
Brain Function: Iron is essential for brain function, as it is involved in the production of neurotransmitters and myelin, which protects nerve fibers in the brain and spinal cord.
Collagen Synthesis: Iron is involved in the synthesis of collagen, a protein that is important for the health of skin, bones, and other tissues.
It is important to maintain an adequate iron intake, as a lack of iron can lead to iron-deficiency anemia, a condition in which the body doesn't have enough red blood cells to carry oxygen. This can result in fatigue, weakness, and other symptoms
INTRODUCTION OF IRON

Iron is a chemical element with the symbol Fe and atomic number 26. It is a metal that is essential for human health and is involved in many biological processes in the human body. Some of the key functions of iron in the human body include:

Oxygen Transport: Iron is a critical component of hemoglobin, a protein in red blood cells that carries oxygen from the lungs to the tissues throughout the body.Energy Metabolism: Iron is involved in various metabolic processes that produce energy for the body, including the production of ATP.Enzyme Function: Iron is a cofactor for several enzymes that are involved in various metabolic reactions.Immune Function: Iron is essential for the normal function of the immune system, including the production of white blood cells.Brain Development: Iron is important for proper brain development, especially in infants and children.

It's important to have enough iron in the diet to maintain good health. However, too much iron can be harmful, so it's important to consult a doctor before taking iron supplements.

Hope my answer helps you!

A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicated DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? O The chemical disrupts hydrogen bonding. O The chemical inhibits DNA ligase. O The chemical blocks DNA polymerase. O The chemical prevents the formation of RNA primers.

Answers

The evidence is strongest in favour of the chemical's claim that it inhibits DNA ligase.

These strands are split apart in the replication process. Semiconservative replication is the process by which each strand of a original DNA molecule is used as a template to create its counterpart. RNA polymerase starts the transcription process with the aid of the sigma factor. 2. In prokaryotes, RNA polymerase also helps the leading strand—a continuously synthesised strand—open the DNA double helix. It's more difficult to use the other new strand, that also extends 5 to 3 feet from the fork. Because the DNA polymerase must separate as the fork advances and then reattach on the exposed DNA, this strand is created in fragments.

(A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicate DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). 5' -3' TAOGGCGTTAGACAAGTGCGTGAGTA CACA ATGCCGCAATстаттCACGCACTCATGTGT 3' 11 TL5' Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? (A) The chemical prevents the formation of RNA primers. (B) The chemical inhibits DNA ligase. (C) The chemical blocks DNA polymerase. The chemical disrupts hydrogen bonding.)

Learn more about DNA

https://brainly.com/question/264225

#SPJ4

question mode fill in the blank question fill in the blank question. leukopoiesis involves three different types of maturation processes______; maturation, maturation, and lymphocyte maturation.

Answers

Granulocyte maturation, monocyte maturation, and lymphocyte maturation are three separate types of maturation processes that are involved in leukopoiesis. Myeloid stem cells create monocytes and granulocytes. A lymphoid stem cell is the source of lymphocytes.

Leukocytes' (WBC's) course of development of leukopoiesis is the process through which leukocytes are produced.

The process of creating leukocytes (white blood cells) from pluripotent bone marrow hematopoietic stem cells. There are two important processes that generate different types of leukocytes: myelopoiesis, in which blood leukocytes are derived from myeloid stem cells, and lymphopoiesis, in which lymphoid stem cells give rise to lymphocytes.

Learn more about leukocytes here: https://brainly.com/question/822519

#SPJ4

which of the following is an example of something jane goodall observed during her research on chimpanzees?

Answers

Jane Goodall's famous research on chimpanzees is a classic example of naturalistic observation.

What was Jane Goodall's research about?

Jane Goodall was the first person to observe chimpanzees creating and using tools—a trait that, at that time, was thought to be distinctly human. This discovery changed the way that we understand both animals and ourselves.

When the chimp pulled the leaves back out, Jane saw the gleam of water. The chimp then put the wet leaves back in its mouth. might automatically infer that she got a good grade. Inferences are not always correct, however.

Jane Goodall is an expert on wild chimpanzees. Recognized for her ground breaking discoveries about their behavior – she discovered that chimpanzees make tools, eat and hunt for meat, and have similar social behavior to humans.

Learn more about Jane Goodall's:

https://brainly.com/question/16544618

#SPJ1

A product that maintains a large market share in the industry even though that industry does not have a high growth rate is considered to be a _______.

Answers

A product that maintains a large market share in the industry even though that industry does not have a high growth rate is considered to be a Cash cow.

Products with a sizable market share in a sector with slow growth rates are referred to as cash cows in the BCG matrix59. Within the BCG matrix, the VHS tape would be categorized as a DOG since it belongs to a product category where no company has a sizable market share and where the growth pace has essentially stopped.

In business parlance, a cash cow is an enterprise that consistently produces earnings that are significantly higher than the capital expenditure needed to launch or buy it. Since these enterprises can be utilized to increase a company's overall revenue and to support less profitable initiatives, many organizations try to establish or acquire them.

know more about Cash cow here

https://brainly.com/question/16818101#

#SPJ4

figure 2: summary of the resolution and time span of record for proxy data sources. the top horizontal axis indicates the period for which the proxy data can be collected (e.g., tree rings can provide information on the climate for periods of hundreds to thousands of years). the bottom horizontal axis indicates the resolution available for the proxy data (e.g., tree rings provide annual resolution of the climate). drag the appropriate items into their respective bins. each item may be used only once.

Answers

Proxy data sources are data obtained from physical, chemical or biological materials that are indirect indicators of climate conditions.

The resolution of the proxy data refers to the level of detail it provides, e.g. annual or decadal. The time span of the record indicates the period of time for which the proxy data can provide climate conditions information, e.g. hundreds to thousands of years. The combination of the time span and resolution of the record allows scientists to reconstruct past climate conditions. For example, tree rings provide a high resolution of annual information for periods of hundreds to thousands of years. Other examples of proxy data sources include ice cores, sediment layers and pollen.

Learn more about  climate conditions here:

https://brainly.com/question/19127146

#SPJ4

The complete Question is:

What is the purpose of Figure 2 and how does it summarize the resolution and time span of record for proxy data sources?

options: dominant, recessive some, all

Answers

Answer: dominant

Explanation:

which of the following best predicts the effect of inserting this gene into the dna of a bacterial cell?

Answers

The expression of a gene, which results in the creation of a protein or other product encoded by the gene, can be induced by inserting a gene into the DNA of a bacterial cell.

Depending on how this protein or product performs, the cell may then be affected. The new gene would be inserted into the DNA sequence. The sequence would be altered specifically according to the gene and the intended position. The DNA sequence would be cut at that spot and the new gene would be spliced into it, for instance, if the gene had to be placed at a certain site in the DNA. As single-celled prokaryotic organisms, bacteria cells lack a nucleus and other organelles. They have a cell wall that aids in cellular protection and a cell membrane that controls what enters and exits the cell.

To know more about DNA refer to the link below :

brainly.com/question/264225

#SPJ4

subliminal processing refers to the way in which consumers can be influenced without their brains sensing exposure to any kind of stimuli. (True or False)

Answers

The term "subliminal processing" describes how customers can be persuaded without their brains registering any exposure to stimuli. false.

A subliminal stimulus is a type of stimulus that, although it may be detected & processed in the brain, does not cause consciousness of perception, according to psychological study. A recipient of the a subliminal stimulus, for example, could be able to sense it but not necessarily be aware of it. The term "subliminal processing" describes how the human brain detects weak stimuli, or stimuli that happen below the threshold of conscious consciousness. Consumer exposure to and awareness to marketing stimuli is the first step in the perceptual process, which concludes with consumer interpretation. Reality and how customers perceive it are frequently extremely different

Learn more about brain

https://brainly.com/question/2664243

#SPJ4

Which of the following DNA sequences must be found in a prokaryotic cell for transcription to be possible? (hint: what molecules are important for transcription?) (Choose ALL correct answers)Select all that applyA gene encoding rRNAA promoterA gene encoding the sigma proteinA gene encoding the RNA polymerase protein

Answers

The DNA sequences must be found in a prokaryotic cell for transcription to be possible in a promoter.

Thus, the correct option is B.

The process of trаnscription begins when аn enzyme cаlled RNА polymerаse (RNА pol) аttаches to the templаte DNА strаnd аnd begins to cаtаlyze production of complementаry RNА. Polymerаses аre lаrge enzymes composed of аpproximаtely а dozen subunits, аnd when аctive on DNА, they аre аlso typicаlly complexed with other fаctors. In mаny cаses, these fаctors signаl which gene is to be trаnscribed.

The first step in trаnscription is initiаtion, when the RNА pol binds to the DNА upstreаm (5′) of the gene аt а speciаlized sequence cаlled а promoter. In bаcteriа, promoters аre usuаlly composed of three sequence elements, whereаs in eukаryotes, there аre аs mаny аs seven elements.

Your options aren't well arranged, but most probably your options were

a. A gene encoding rRNA

b. A promoter

c. A gene encoding the sigma protein

d. A gene encoding the RNA polymerase protein

Thus, B is the correct option is B.

For more information about DNA transcription refers to the link:

https://brainly.com/question/12386

#SPJ4

Which of the following substances can diffuse across only sinusoid capillaries and not other capillaries?
a) plasma proteins
b) glucose
c) insulin
d) amino acids

Answers

Only sinusoid capillaries are capable of facilitating the diffusion of plasma proteins substances.

Plasma proteins, also known as blood proteins, are the proteins found in blood plasma. They perform a variety of tasks, such as lipid, hormone, vitamin, and mineral transport, immune system activity, and immune system functioning.

The liquid component of whole blood is called plasma. Plasma is whole blood devoid of erythrocytes, leukocytes, and platelets (RBCs, WBCs). Plasma without fibrinogen makes up serum, which is occasionally mistakenly thought to be synonymous with plasma. It consists primarily of:

Coagulants, particularly fibrinogen, help blood clot.The colloidal osmotic pressure is kept at a level of about 25 mmHg by plasma proteins like albumin and globulin.Calcium, sodium, potassium, bicarbonate, chloride, and other electrolytes all help to maintain blood pH.Immunoglobulins and various other minor amounts of enzymes, hormones, and vitamins aid in the fight against infection.

Learn more about ' Immune System ' visit here;

https://brainly.com/question/19843453

#SPJ4

Use the drawling tools to form the correct answer on the graph.
Graph the line that represents this equation: y+2 = 1/2 (x+2)

Answers

The graph for the line that represents this equation: y+2 = 1/2 (x+2) is attached.

What is a line?

It should be noted that a line is a one-dimensional shape that is straight, has no thickness, and extends in both directions indefinitely. The equation of a line is given by,

y =mx + c

where,

x is the coordinate of the x-axis,

y is the coordinate of the y-axis,

m is the slope of the line, and

c is constant.

In this case, the graph of the line y +2 = 1/2 (x + 2), can be drawn as is shown below.

Learn more about graph on:

https://brainly.com/question/24115285

#SPJ1

The mechanism by which evolution occurs is called:

A, Creationism
B, Natural selection
C, Lamarckism
D, Metabolism
E, Artificial selection

Answers

Answer:

it is called natural selection

Answer:

natural selection (b)

Explanation:

It is well known that the main driving forces of evolution in any population are mutation, natural selection, genetic drift, and gene flow. The ability of these driving forces to perform their role is dependent on the amount of genetic diversity within and among populations.

which of the following structural features of e. coli is most responsible for the signs and symptoms of a urinary tract infection?

Answers

The flagella of Escherichia coli (E. coli) are the most responsible for the signs and symptoms of a urinary tract infection.

Flagellum is referred as a motility organelle which enables the movement and chemotaxis. Bacteria have one or several flagella which can be  either polar or peritrichous.

A flagellum is defined as a hairlike appendage which comes from certain plant and animal sperm cells. They from a wide range of microorganisms to provide motility.

The flagella permits the bacterium to move and occupy the bladder which causes inflammation and infection. This results in symptoms such as pain or burning during urination, frequent urge to urinate, cloudy or strong-smelling urine, and lower abdominal pain.

To know more about flagella refer to-

brainly.com/question/13452834#

#SPJ4

Complete question

Which structural features of e. coli is most responsible for the signs and symptoms of a urinary tract infection?

Spillage is a problem associated with which of the following types of mining?

Responses

surface mining

fracking

sub-surface mining

drilling

Answers

Spillage is a problem associated with drilling

What is drilling of oil?

Drilling for oil is the process of creating a well to extract petroleum from underground reservoirs. The process begins with the selection of a suitable site, usually based on geological data, aerial surveys, and seismic studies. Next, a rig is constructed and equipment is brought to the site to drill the well.

The extracted oil is then transported to a processing facility for refining and distribution. Drilling for oil is a complex and expensive process, but it is essential for meeting the world's growing energy needs.

Learn more about oil drilling:https://brainly.com/question/29752686

#SPJ1

Which of the following statements are true about double-stranded DNA? a. A+C=T+G b. A+G=C+T c. A+T=G+C d. A/G = C/T e. A/G = T/C f. (C+A)/(G+T)=1

Answers

statements true about double-stranded DNA are a. A+C=T+G b. A+G=C+T  e. A/G = T/C . it consists of two polynucleotide chains.

An rapid repair is required for DNA double-strand breaks (DSBs), which are cytotoxic lesions. A DSB can be repaired by a number of metabolic processes that have emerged. Gene conversion is one of the least error-prone methods for repairing a DNA double-strand break (DSB). Although this is the case, gene conversion is associated with a nearly 1000-fold rise in mutation rate. Gene conversion is not only linked to increased mutation rates, but also to more specific mutation profiles when compared to spontaneous mutation occurrences. Extremely frequent frameshift mutation events and other complicated alterations that are not present during typical DNA replication are characteristics of gene conversion.

learn more about double-stranded DNA here

https://brainly.com/question/15082078

#SPJ4

a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? mrna splicing formation of new transcription factors dna replication rate translation rate

Answers

A single-stranded RNA genome from a recently discovered virus is used as mRNA after infection. The translation rate method is the one that should be used to study how this virus replicates in a host cell. The correct answer is option(c).

The genome is the whole set of DNA demands in the direction of a container. In persons, the genome resides of 23 pairs of chromosomes situated in the container's core, in addition to a limited chromosome in the container's mitochondria. A genome holds all the new wanted for an individual to expand and function.

The rate of DNA translation changes contingent upon the type of creature. Prokaryotes can turn DNA at 21 amino acids per second, while eukaryotes interpret at a rate of 9 amino acids per second. It was found that the following visage was equated accompanying translation rate: codon habit commonness, few gene knowledge advancement scores, number of RNA binding proteins popular to bind allure mRNA amount, systematize series distance, protein affluence, and 5′UTR free strength.

To know more about genome refer to: https://brainly.com/question/29598514

#SPJ4

The complete question is:

A newly identified virus has a single-stranded RNA genome that is used as mRNA after infection. Its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. Which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell?

A) DNA replication rate

B) mRNA splicing

C) translation rate

D) formation of new transcription factors

blood types are classified on the basis of the presence of three antigens, called thea, b, and rh antigens. for example

Answers

Red blood cells with blood group A antigens from the ABO system and anti-B antibodies. plasma anti-A antibodies and blood group B antigens.  A and a B antigens are present in blood group AB, but there are no antibodies.

Red blood cells' inherited characteristics are based on the presence or absence of antigens A and B, which are carried on their surface, and are used to categorise human blood according to the ABO blood group system. As a result, individuals may well have type A, type B, type O, as well as type AB blood. Red blood cells with blood group A antigens from the ABO system and anti-B antibodies. plasma anti-A antibodies and blood group B antigens.  A and a B antigens are present in blood group AB, but there are no antibodies.Transmembrane proteins called Rh antigens, also known as Rhesus antigens, are expressed on the surface of erythrocytes.

Learn more about blood

https://brainly.com/question/17890844

#SPJ4

referring to environmental factors that affect genes and genetic expression; enhancing, halting, shaping, or altering the expression of genes, resulting in a phenotype that may differ markedly from the genotyp

Answers

Environmental factors that affect genes and genetic expression are known as epigenetic influences.

These influences can interact with the genetic code to enhance, halt, shape, or alter the expression of genes, resulting in a phenotype (observable physical characteristics) that may differ markedly from the genotype (the underlying genetic code).

Epigenetic changes can be caused by a variety of environmental factors, including nutrition, toxins, stress, and behavior.

These changes can occur in response to specific stimuli, such as changes in diet, exposure to toxins, or stress, and can then be passed down from one generation to the next, allowing an organism to adapt to its environment.

To learn more about epigenetic influences

https://brainly.com/question/29036896

#SPJ4

plant mass actually comes from

Answers

Answer:

One of the earliest experiments to determine the answer to this question was performed by van Helmont in the 1600s. He planted a 2 kg willow tree in a sealed pot that contained 90 kg of dried soil. He watered the pot with rainwater. After five years, he found that the willow weighed 77 kg while only 60 grams of soil were missing. He concluded that the added weight of the plant arose out of the water. [1]

In light of our knowledge of photosynthesis, we know that the weight added is due to both atmospheric carbon dioxide and water. What's interesting is that John Woodward discovered that more than water contributed to the mass of the plant in 1699.[2] About 100 years later, in 1796, Senbier showed that carbon dioxide was utilized by plants in photosynthesis. In 1797, de Saussure demonstrated that both carbon dioxide and water, along with light, are required for plants to gain mass. [3], [4]

So in the end, we (mostly) add mass via

nCO2+nH2O+light→(CH2O)n+nO2

(CH2O)n can be utilized in many forms. For example, cellulose is a polysaccharide formed from many units of glucose C6H12O6 linked together.

Photosynthesis does account for most of the mass that is added within a plant. Of course, there are other important nutrients that plants need. One of the most important is magnesium, which is at the centre of the chlorophyll molecule. These other nutrients come from the soil.

Explanation:

≤hope it helps≥
Other Questions
keely is looking at leasing a car for 24 months in order to lease the car she needs to give the dealership $750 White tailed deer begin their reproductive cycle in the fall. Rising testosterone levels inmale white tailed deer cause them to start their breeding season around the sametime. Offspring are born the following spring and summer.What is the most likely explanation for the white-tailed deer having a seasonalbreeding cycle instead of a monthly breeding cycle? At conditions of Standard Temperature and Pressure, determine how many liters of hydrogen gas are produced by placing a zinc nail with a mass of 2.2g into an excess of hydrochloric acid.A) 0.0015LB) 0.75LC) 1.33LD) 6.42L today, you are investing $25,000 at 6 percent, compounded monthly, for 10 years. how much additional income could you earn if you could have invested this amount at 7 percent, compounded monthly? In an experiment searching for the photoelectric effect, an incident beam of green light did not eject any electrons from a metal. in order to eject electrons, the experimenter should? which of the following are ways of expressing the meaning of ceteris paribus? multiple select question. assuming other things remain constant assuming additional factors, other than those under consideration, are given equal consideration assuming factors other than those being considered in a particular analysis do not change assuming additional factors, other than those under consideration, play a significant role in analysis which actions should be taken by the nurse when caring for a client that has refused prescribed medications? What is the molecular formula for a compound that is 34.31% sodium, 17.93% carbon, 47.76% oxygen, and has a molar mass of 134.00g? Find an nth-degree polynomial function with real coefficients satisfying the given conditions. If you are using a graphing utility, use it to graph the function and verify the real zeros and the given functionvalue.n=4;- 1, 4, and 4 + 4i are zeros;f(1) = - 150 Bankruptcy matters are handled by local courts.O TrueO False to complete the required reading of a real, credible, and sourced newspaper such as the new york times or the washington post a student must (q011) water can be used to dilute and clean up oil paint, because oil uses a natural binder: linseed oil, which is made from flax plants. T/F graph g has vertex set {v1, v2, v3, v4, v5} and end edge set {e1, e2, e3, e4}, with edge point function as follow: fill in the blanks by typing your answer in the boxes. researchers use a special vocabulary to make judgments about the worth of a theory of communication. sometimes, a theory has been in use for many years and continues to hold value. we say it has passed the test of . a theory might also have practical value that makes it useful for everyday application, which is the criterion of . how broad or narrowly the theory is focused is called its . when a theory is developed so that it that it satisfactorily explains communication behavior in a way that employs the fewest concepts that are relatively easy to understand, it has met the standard of . lastly some theories have a lot of impact because of the way they stimulate new ways of thinking and theorizing byond what the initial theoriest had focused upon. then we value a theory for its . suppose that one of the 400 accidents is chosen at random. what is the probability that the accident involved more than a single vehicle? given an arraylist initialized with the values [6, 5, 4, 3, 2, 1], how many times does line 19 execute when the arraylist is sorted using the selection sort algorithm? at the end of the year, xavier received a form from his employer that reported annual earnings and the amounts deducted for taxes. that form is called a: What are the partitions the segment into a ratio of 1 to 2 a storage room is 4 yards long by 3 yards wide by 1 1/2. a yard is 27 feet. how many cubic feet is the shed a patient is concerned about the baseline variability in the heart rate of her fetus. which responses by the nurse describe the significance of baseline variability to the patient?