studocu mutations are simply changes in the sequence of nucleotides. there are three ways this occurs: 1. change a nucleotide(s) 2. remove a nucleotide(s) 3. add a nucleotide(s)

Answers

Answer 1

Mutations occur through changes, removal, and addition of nucleotides.

Mutations are simply changes in the sequence of nucleotides in DNA. There are three ways that mutations occur: 1) change of a nucleotide(s), where one nucleotide is substituted for another; 2) removal of a nucleotide(s), where one or more nucleotides are deleted from the sequence; and 3) addition of a nucleotide(s), where one or more nucleotides are inserted into the sequence. These mutations changes in the sequence of nucleotides can have a range of effects on the function of the resulting protein, and can contribute to the evolution of species over time.

Learn more about Mutations here:

https://brainly.com/question/17031191

#SPJ4

The Complete Question is :
What are the three ways that mutations occur in the sequence of nucleotides?


Related Questions

a species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. which of the following will be true of this species' response to natural selection?

Answers

Option A, A species that has evolved an asexual mode of reproduction by having unfertilized eggs will likely have a slower response to natural selection compared to sexually reproducing species.

Asexual reproduction does not involve the exchange of genetic material through sexual recombination. As a result species, asexual populations tend to have less genetic diversity, which can make it more difficult for the population to adapt to changes in the natural selection environment. In sexually reproducing species, new combinations of genes can arise through sexual recombination, providing a greater pool of genetic diversity that can be acted upon by natural selection. This can allow sexually reproducing species to more rapidly evolve in response to environmental changes.

Learn more about natural selection here:

https://brainly.com/question/23929271

#SPJ4

The complete Question is:

A species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. Which of the following will be true of this species' response to natural selection?

(a)-There will be less genetic variation from recombination and a risk of not adapting quickly to environmental change.

(b)-The species will increase in numbers because genetic variation is increased.

(c)-There will be fewer deaths from natural selection because sexual recombination always leads to extinction.

(d)-There will be more deaths from natural selection because there is no mutation.

(e)-The species will compensate for loss of genetic variation by hybridizing with other species.

What is the reason for the small number of electrons in the shell closest to the nucleus?

Answers

Each electron shell has a different energy level, with the electron shells closest to the nucleus having a lower energy level than those furthest from the nucleus.

Why does the electron shell nearest to the nucleus have the lowest energy?

Energy-level-varying electrons float about the atom. Orbitals and sub-orbitals make up energy levels. The distance between an electron and the nucleus increases with decreasing energy levels.

The nucleus has a greater number of protons than electrons, which increases the strength of the attraction between them. The electrons that are closer to the nucleus have less energy as a result. An electron is more stable and advantageously positioned in a shell that is closer to the nucleus than one that is further from the nucleus because the energy of the closest shells to the nucleus is typically lower than the energy of the farthest shells.

To know more about nucleus refer to:

https://brainly.com/question/5223117

#SPJ1

subliminal processing refers to the way in which consumers can be influenced without their brains sensing exposure to any kind of stimuli. (True or False)

Answers

The term "subliminal processing" describes how customers can be persuaded without their brains registering any exposure to stimuli. false.

A subliminal stimulus is a type of stimulus that, although it may be detected & processed in the brain, does not cause consciousness of perception, according to psychological study. A recipient of the a subliminal stimulus, for example, could be able to sense it but not necessarily be aware of it. The term "subliminal processing" describes how the human brain detects weak stimuli, or stimuli that happen below the threshold of conscious consciousness. Consumer exposure to and awareness to marketing stimuli is the first step in the perceptual process, which concludes with consumer interpretation. Reality and how customers perceive it are frequently extremely different

Learn more about brain

https://brainly.com/question/2664243

#SPJ4

plant mass actually comes from

Answers

Answer:

One of the earliest experiments to determine the answer to this question was performed by van Helmont in the 1600s. He planted a 2 kg willow tree in a sealed pot that contained 90 kg of dried soil. He watered the pot with rainwater. After five years, he found that the willow weighed 77 kg while only 60 grams of soil were missing. He concluded that the added weight of the plant arose out of the water. [1]

In light of our knowledge of photosynthesis, we know that the weight added is due to both atmospheric carbon dioxide and water. What's interesting is that John Woodward discovered that more than water contributed to the mass of the plant in 1699.[2] About 100 years later, in 1796, Senbier showed that carbon dioxide was utilized by plants in photosynthesis. In 1797, de Saussure demonstrated that both carbon dioxide and water, along with light, are required for plants to gain mass. [3], [4]

So in the end, we (mostly) add mass via

nCO2+nH2O+light→(CH2O)n+nO2

(CH2O)n can be utilized in many forms. For example, cellulose is a polysaccharide formed from many units of glucose C6H12O6 linked together.

Photosynthesis does account for most of the mass that is added within a plant. Of course, there are other important nutrients that plants need. One of the most important is magnesium, which is at the centre of the chlorophyll molecule. These other nutrients come from the soil.

Explanation:

≤hope it helps≥

figure 2: summary of the resolution and time span of record for proxy data sources. the top horizontal axis indicates the period for which the proxy data can be collected (e.g., tree rings can provide information on the climate for periods of hundreds to thousands of years). the bottom horizontal axis indicates the resolution available for the proxy data (e.g., tree rings provide annual resolution of the climate). drag the appropriate items into their respective bins. each item may be used only once.

Answers

Proxy data sources are data obtained from physical, chemical or biological materials that are indirect indicators of climate conditions.

The resolution of the proxy data refers to the level of detail it provides, e.g. annual or decadal. The time span of the record indicates the period of time for which the proxy data can provide climate conditions information, e.g. hundreds to thousands of years. The combination of the time span and resolution of the record allows scientists to reconstruct past climate conditions. For example, tree rings provide a high resolution of annual information for periods of hundreds to thousands of years. Other examples of proxy data sources include ice cores, sediment layers and pollen.

Learn more about  climate conditions here:

https://brainly.com/question/19127146

#SPJ4

The complete Question is:

What is the purpose of Figure 2 and how does it summarize the resolution and time span of record for proxy data sources?

Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color, and find that 68% answered Brown. 1. What is the population? all people in the country [ Select] 2. What is the sample? [Se all people in the country 2500 people all people who use hair color 3. What is the variable here? [ Select] 4. List possible data values. [Select ] 5. The parameter of interest is [Select ] > 6. The statistic computed is [Select ]

Answers

The term "population" refers to all citizens who are either permanently residing in a country or who are just passing through.

This indicator reveals how many people typically reside in a certain location. Growth rates are indeed the population changes that occur each year as a result of births, deaths, and net migration. Changing the colour of one's hair is known as "hair colouring" or "hair dyeing." The primary explanations for this are aesthetic: restore the original hair colour after it has been faded by hairstyling procedures or sun bleaching, hide grey or white hair, or alter to a hue seen to be more trendy or attractive. Population refers to the total amount of people residing in a specific location at any one moment.

(Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color. Identify the population a. people who color their hair b.all women call individuals in the country d. all adult males in the country)

Learn more about population

https://brainly.com/question/21654221

#SPJ4

Use the drawling tools to form the correct answer on the graph.
Graph the line that represents this equation: y+2 = 1/2 (x+2)

Answers

The graph for the line that represents this equation: y+2 = 1/2 (x+2) is attached.

What is a line?

It should be noted that a line is a one-dimensional shape that is straight, has no thickness, and extends in both directions indefinitely. The equation of a line is given by,

y =mx + c

where,

x is the coordinate of the x-axis,

y is the coordinate of the y-axis,

m is the slope of the line, and

c is constant.

In this case, the graph of the line y +2 = 1/2 (x + 2), can be drawn as is shown below.

Learn more about graph on:

https://brainly.com/question/24115285

#SPJ1

Which of the following statements are true about double-stranded DNA? a. A+C=T+G b. A+G=C+T c. A+T=G+C d. A/G = C/T e. A/G = T/C f. (C+A)/(G+T)=1

Answers

statements true about double-stranded DNA are a. A+C=T+G b. A+G=C+T  e. A/G = T/C . it consists of two polynucleotide chains.

An rapid repair is required for DNA double-strand breaks (DSBs), which are cytotoxic lesions. A DSB can be repaired by a number of metabolic processes that have emerged. Gene conversion is one of the least error-prone methods for repairing a DNA double-strand break (DSB). Although this is the case, gene conversion is associated with a nearly 1000-fold rise in mutation rate. Gene conversion is not only linked to increased mutation rates, but also to more specific mutation profiles when compared to spontaneous mutation occurrences. Extremely frequent frameshift mutation events and other complicated alterations that are not present during typical DNA replication are characteristics of gene conversion.

learn more about double-stranded DNA here

https://brainly.com/question/15082078

#SPJ4

which of the following best predicts the effect of inserting this gene into the dna of a bacterial cell?

Answers

The expression of a gene, which results in the creation of a protein or other product encoded by the gene, can be induced by inserting a gene into the DNA of a bacterial cell.

Depending on how this protein or product performs, the cell may then be affected. The new gene would be inserted into the DNA sequence. The sequence would be altered specifically according to the gene and the intended position. The DNA sequence would be cut at that spot and the new gene would be spliced into it, for instance, if the gene had to be placed at a certain site in the DNA. As single-celled prokaryotic organisms, bacteria cells lack a nucleus and other organelles. They have a cell wall that aids in cellular protection and a cell membrane that controls what enters and exits the cell.

To know more about DNA refer to the link below :

brainly.com/question/264225

#SPJ4

Which of the following DNA sequences must be found in a prokaryotic cell for transcription to be possible? (hint: what molecules are important for transcription?) (Choose ALL correct answers)Select all that applyA gene encoding rRNAA promoterA gene encoding the sigma proteinA gene encoding the RNA polymerase protein

Answers

The DNA sequences must be found in a prokaryotic cell for transcription to be possible in a promoter.

Thus, the correct option is B.

The process of trаnscription begins when аn enzyme cаlled RNА polymerаse (RNА pol) аttаches to the templаte DNА strаnd аnd begins to cаtаlyze production of complementаry RNА. Polymerаses аre lаrge enzymes composed of аpproximаtely а dozen subunits, аnd when аctive on DNА, they аre аlso typicаlly complexed with other fаctors. In mаny cаses, these fаctors signаl which gene is to be trаnscribed.

The first step in trаnscription is initiаtion, when the RNА pol binds to the DNА upstreаm (5′) of the gene аt а speciаlized sequence cаlled а promoter. In bаcteriа, promoters аre usuаlly composed of three sequence elements, whereаs in eukаryotes, there аre аs mаny аs seven elements.

Your options aren't well arranged, but most probably your options were

a. A gene encoding rRNA

b. A promoter

c. A gene encoding the sigma protein

d. A gene encoding the RNA polymerase protein

Thus, B is the correct option is B.

For more information about DNA transcription refers to the link:

https://brainly.com/question/12386

#SPJ4

magnesium reacts with oxygen to produce magnesium oxide calculate the percentage mass of magnesium in magnesium oxide relative atomic mass mg= 24 relative formula mass mgO=40

Answers

Answer:

24÷40×100%=60%

Explanation:

divide atomic mass by relative mass the multiply by 100%

Dr.Griffin is treating a young couple who are having a child. The parents are worried that since the mo a carrier for the disorder of color blindness that the child will have color blindness as well. The father does not have color blindness. What are the chances that the child will NOT have color blindness? Use X for no color blindness and X for having color blindness
Pls helppp

Answers

The child has a 50% chance of having color blindness (Xc) and a 50% chance of not having color blindness (XX).

What is color blindness?

Color blindness, also known as color vision deficiency, is a condition in which an individual has difficulty seeing certain colors, or a reduced ability to distinguish between certain colors.

The chances of the child NOT having color blindness depend on the genetic makeup of the mother and the father. If the mother is a carrier of the color blindness gene (Xc), she has one normal allele (X) and one mutant allele (c). The father does not have color blindness, so he has two normal alleles (XX).

The chance of the child inheriting the normal allele from the mother is 50%. The chance of the child inheriting the normal allele from the father is 100%. Therefore, the overall chance of the child NOT having color blindness is 50% * 100% = 50%. This means that the child has a 50% chance of having color blindness (Xc) and a 50% chance of not having color blindness (XX).

Learn more about color blindness, here:

https://brainly.com/question/29807811

#SPJ1

The mechanism by which evolution occurs is called:

A, Creationism
B, Natural selection
C, Lamarckism
D, Metabolism
E, Artificial selection

Answers

Answer:

it is called natural selection

Answer:

natural selection (b)

Explanation:

It is well known that the main driving forces of evolution in any population are mutation, natural selection, genetic drift, and gene flow. The ability of these driving forces to perform their role is dependent on the amount of genetic diversity within and among populations.

professor marcus is studying gene expression in the liver cells of a mouse. she observes that when a steroid hormone enters the liver cells, the cells begin producing a wide variety of new proteins. which of the following statements is the most useful to include in an explanation of this observation?

Answers

The most useful statement to include in an explanation of Professor Marcus's observation is that steroid hormones can activate gene expression by binding to specific receptors in the liver cells, leading to the initiation of a series of molecular events that ultimately result in the production of new proteins.

This highlights the role of hormones in regulating gene expression, and the complex mechanisms by which they control cellular processes. It also emphasizes the importance of studying gene expression in understanding cellular and physiological processes.

The translation of messenger RNA (mRNA) into proteins is known to be modulated by steroid hormones, which include, among others, progestogen, oestrogen, glucocorticoid, and androgen.

It has been demonstrated that sex steroid hormones in mammals influence the expression of important genes, such as the prolactin gene needed for milk production.

To learn more about steroid hormones

https://brainly.com/question/29382368

#SPJ4

referring to environmental factors that affect genes and genetic expression; enhancing, halting, shaping, or altering the expression of genes, resulting in a phenotype that may differ markedly from the genotyp

Answers

Environmental factors that affect genes and genetic expression are known as epigenetic influences.

These influences can interact with the genetic code to enhance, halt, shape, or alter the expression of genes, resulting in a phenotype (observable physical characteristics) that may differ markedly from the genotype (the underlying genetic code).

Epigenetic changes can be caused by a variety of environmental factors, including nutrition, toxins, stress, and behavior.

These changes can occur in response to specific stimuli, such as changes in diet, exposure to toxins, or stress, and can then be passed down from one generation to the next, allowing an organism to adapt to its environment.

To learn more about epigenetic influences

https://brainly.com/question/29036896

#SPJ4

in the following list, choose all that are considered complex tissues. multiple select question. xylem periderm sclerenchyma phloem epidermis parenchyma

Answers

According to the given lists xylem, phloem, and periderm are considered complex tissues.

Complex tissues are containing various types of cells, that is asserted. These tissues function as administering tissues as well as various types of cells agree as a part. These tissues are also known as vascular tissues as the correct vascular bundles. It is a somewhat fabric that is to say containing in addition to individual types of cells, and so forth the cells coordinate to act an average function. It resides in parenchyma and sclerenchyma cells. The names of a few complex tissues are the xylem and phloem.

The xylem and phloem are famous as complex tissues as they are containing as well individual types of cells. The complex fabric present in the xylem and phloem is vascular fabric. It is an attending fabric. Its main function searches to conduct or transport fluid and vitamins from individual parts to other parts of the plant.

To know more about xylem refer to: https://brainly.com/question/14197052

#SPJ4

A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicated DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? O The chemical disrupts hydrogen bonding. O The chemical inhibits DNA ligase. O The chemical blocks DNA polymerase. O The chemical prevents the formation of RNA primers.

Answers

The evidence is strongest in favour of the chemical's claim that it inhibits DNA ligase.

These strands are split apart in the replication process. Semiconservative replication is the process by which each strand of a original DNA molecule is used as a template to create its counterpart. RNA polymerase starts the transcription process with the aid of the sigma factor. 2. In prokaryotes, RNA polymerase also helps the leading strand—a continuously synthesised strand—open the DNA double helix. It's more difficult to use the other new strand, that also extends 5 to 3 feet from the fork. Because the DNA polymerase must separate as the fork advances and then reattach on the exposed DNA, this strand is created in fragments.

(A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicate DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). 5' -3' TAOGGCGTTAGACAAGTGCGTGAGTA CACA ATGCCGCAATстаттCACGCACTCATGTGT 3' 11 TL5' Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? (A) The chemical prevents the formation of RNA primers. (B) The chemical inhibits DNA ligase. (C) The chemical blocks DNA polymerase. The chemical disrupts hydrogen bonding.)

Learn more about DNA

https://brainly.com/question/264225

#SPJ4

introduction of iron and functions of iron in the human body

Answers

Iron is an essential mineral that plays an important role in many of the body's functions. Here is a brief introduction to iron and its functions in the human body:

Introduction:
Iron is a metallic element that is found in many foods, including red meat, poultry, seafood, beans, lentils, fortified cereals, and some fruits and vegetables. It is also available in supplement form. The human body needs iron to produce hemoglobin, a protein in red blood cells that carries oxygen from the lungs to the rest of the body.

Functions:

Oxygen Transport: Iron is a crucial component of hemoglobin, which helps to transport oxygen from the lungs to the rest of the body.
Energy Production: Iron is involved in energy production, helping to create ATP (adenosine triphosphate), the body's primary energy source.
Immune System Function: Iron is also important for a healthy immune system, as it helps to produce white blood cells that fight infection.
Brain Function: Iron is essential for brain function, as it is involved in the production of neurotransmitters and myelin, which protects nerve fibers in the brain and spinal cord.
Collagen Synthesis: Iron is involved in the synthesis of collagen, a protein that is important for the health of skin, bones, and other tissues.
It is important to maintain an adequate iron intake, as a lack of iron can lead to iron-deficiency anemia, a condition in which the body doesn't have enough red blood cells to carry oxygen. This can result in fatigue, weakness, and other symptoms
INTRODUCTION OF IRON

Iron is a chemical element with the symbol Fe and atomic number 26. It is a metal that is essential for human health and is involved in many biological processes in the human body. Some of the key functions of iron in the human body include:

Oxygen Transport: Iron is a critical component of hemoglobin, a protein in red blood cells that carries oxygen from the lungs to the tissues throughout the body.Energy Metabolism: Iron is involved in various metabolic processes that produce energy for the body, including the production of ATP.Enzyme Function: Iron is a cofactor for several enzymes that are involved in various metabolic reactions.Immune Function: Iron is essential for the normal function of the immune system, including the production of white blood cells.Brain Development: Iron is important for proper brain development, especially in infants and children.

It's important to have enough iron in the diet to maintain good health. However, too much iron can be harmful, so it's important to consult a doctor before taking iron supplements.

Hope my answer helps you!

Spillage is a problem associated with which of the following types of mining?

Responses

surface mining

fracking

sub-surface mining

drilling

Answers

Spillage is a problem associated with drilling

What is drilling of oil?

Drilling for oil is the process of creating a well to extract petroleum from underground reservoirs. The process begins with the selection of a suitable site, usually based on geological data, aerial surveys, and seismic studies. Next, a rig is constructed and equipment is brought to the site to drill the well.

The extracted oil is then transported to a processing facility for refining and distribution. Drilling for oil is a complex and expensive process, but it is essential for meeting the world's growing energy needs.

Learn more about oil drilling:https://brainly.com/question/29752686

#SPJ1

blood types are classified on the basis of the presence of three antigens, called thea, b, and rh antigens. for example

Answers

Red blood cells with blood group A antigens from the ABO system and anti-B antibodies. plasma anti-A antibodies and blood group B antigens.  A and a B antigens are present in blood group AB, but there are no antibodies.

Red blood cells' inherited characteristics are based on the presence or absence of antigens A and B, which are carried on their surface, and are used to categorise human blood according to the ABO blood group system. As a result, individuals may well have type A, type B, type O, as well as type AB blood. Red blood cells with blood group A antigens from the ABO system and anti-B antibodies. plasma anti-A antibodies and blood group B antigens.  A and a B antigens are present in blood group AB, but there are no antibodies.Transmembrane proteins called Rh antigens, also known as Rhesus antigens, are expressed on the surface of erythrocytes.

Learn more about blood

https://brainly.com/question/17890844

#SPJ4

Leukocytes displaying red cytoplasmic granules when treated with Wright's stain are most likely ________.
A. basophils
B. erythrocytes
C. eosinophils
D. monocytes

Answers

Leukocytes displaying red cytoplasmic granules when treated with Wright's stain are most likely eosinophils (C)

Eosinophils are a type of white blood cell that helps the body fight against infections. This situation almost always points to either an infection caused by a parasite, an allergic reaction, or malignancy. Blood eosinophilia refers to an abnormally high number of eosinophils in the blood, while excessive levels of eosinophils in the tissues at the site of an infection or inflammation are known as tissue eosinophilia.

Eosinophils are often the largest type of granulocyte that can be seen in healthy blood. The cytoplasm of these organisms is often colorless or a light blue. On the other hand, the big granules that are present almost always serve to conceal the hue. Because they have absorbed the acidic components of the Wright stain, these granules have taken on a reddish orange color.

To learn more about eosinophils, click here:

https://brainly.com/question/10688608

#SPJ4

which of the following is NOT true of ATP

A.) The hydrolysis of ATP is an exergonic process

B.) Energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, NOT from the phosphate bond itself

C.) ATP has less potential energy than ADP

D.) the release of a phosphate in ATP hydrolysis is often used to do exergonic work of a cell

Answers

The energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, and not from the phosphate bond itself. ADP has less potential energy than ATP. Thus, the correct options are B and C.

What is ATP hydrolysis?

ATP hydrolysis is the catabolic reaction process through which the chemical energy that has been stored in the high-energy phospho-anhydride bonds in the ATP (adenosine triphosphate) is released after the splitting of these bonds, for example in the muscles, by producing work in the form of mechanical energy.

Energy from the hydrolysis of ATP is an exergonic process. This energy from ATP hydrolysis comes from the phosphate bond itself. ADP has less potential energy than ATP.

Therefore, the correct options are B and C.

Learn more about ATP here:

https://brainly.com/question/14637256


#SPJ1

A product that maintains a large market share in the industry even though that industry does not have a high growth rate is considered to be a _______.

Answers

A product that maintains a large market share in the industry even though that industry does not have a high growth rate is considered to be a Cash cow.

Products with a sizable market share in a sector with slow growth rates are referred to as cash cows in the BCG matrix59. Within the BCG matrix, the VHS tape would be categorized as a DOG since it belongs to a product category where no company has a sizable market share and where the growth pace has essentially stopped.

In business parlance, a cash cow is an enterprise that consistently produces earnings that are significantly higher than the capital expenditure needed to launch or buy it. Since these enterprises can be utilized to increase a company's overall revenue and to support less profitable initiatives, many organizations try to establish or acquire them.

know more about Cash cow here

https://brainly.com/question/16818101#

#SPJ4

question mode fill in the blank question fill in the blank question. leukopoiesis involves three different types of maturation processes______; maturation, maturation, and lymphocyte maturation.

Answers

Granulocyte maturation, monocyte maturation, and lymphocyte maturation are three separate types of maturation processes that are involved in leukopoiesis. Myeloid stem cells create monocytes and granulocytes. A lymphoid stem cell is the source of lymphocytes.

Leukocytes' (WBC's) course of development of leukopoiesis is the process through which leukocytes are produced.

The process of creating leukocytes (white blood cells) from pluripotent bone marrow hematopoietic stem cells. There are two important processes that generate different types of leukocytes: myelopoiesis, in which blood leukocytes are derived from myeloid stem cells, and lymphopoiesis, in which lymphoid stem cells give rise to lymphocytes.

Learn more about leukocytes here: https://brainly.com/question/822519

#SPJ4

which of the following structural features of e. coli is most responsible for the signs and symptoms of a urinary tract infection?

Answers

The flagella of Escherichia coli (E. coli) are the most responsible for the signs and symptoms of a urinary tract infection.

Flagellum is referred as a motility organelle which enables the movement and chemotaxis. Bacteria have one or several flagella which can be  either polar or peritrichous.

A flagellum is defined as a hairlike appendage which comes from certain plant and animal sperm cells. They from a wide range of microorganisms to provide motility.

The flagella permits the bacterium to move and occupy the bladder which causes inflammation and infection. This results in symptoms such as pain or burning during urination, frequent urge to urinate, cloudy or strong-smelling urine, and lower abdominal pain.

To know more about flagella refer to-

brainly.com/question/13452834#

#SPJ4

Complete question

Which structural features of e. coli is most responsible for the signs and symptoms of a urinary tract infection?

If a cell does not need a particular protein at a given time, which of the following strategies will require use of the least energy/resources (be the most energy/resource efficient) compared to the others? (Choose the ONE best answer)

Answers

Do not transcribe the mRNA from the gene encoding this protein.

A pre-mRNA molecule is created during transcription by the enzyme RNA polymerase II, which is then processed to create mature mRNA. A gene's DNA acts as a model for complementary base pairing.

If a gene is not transcribed in a cell, it cannot be used to make a protein there. A gene's transcription will almost certainly result in the production of a protein (expressed). The more a gene is transcribed, the more protein will typically be produced.

Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the information necessary for protein synthesis.

Learn more about " mRNA " to visit here;

https://brainly.com/question/12903143

#SPJ4

Write a short (2 page) report that includes a Methods section and a Discussion of this data. In the Methods section, describe the data and how you would use them to deduce relationships among different populations. In the Discussion, draw a conclusion about whether domesticated dogs came from different wolf lineages, or all came from the same one. Use your experience with the simulated dogs in this lab to justify your methods and conclusions.

Answers

Report on Domesticated Dog Lineages

Introduction:

The origins of domesticated dogs have been a subject of much interest and study in the fields of genetics, animal behavior, and evolution. In order to understand the relationships among different populations of domesticated dogs, it is necessary to analyze DNA samples from a variety of dogs, including wild wolves and domesticated dogs. This report will describe the methods used to analyze the data, and discuss the results in order to draw a conclusion about the origin of domesticated dogs.

Methods:

Data was collected from DNA samples of domesticated dogs, wild wolves, and hybrid dogs that were generated from crosses between domesticated dogs and wild wolves. The DNA was extracted from the samples and analyzed using polymerase chain reaction (PCR) to amplify specific regions of the mitochondrial DNA. This amplified DNA was then sequenced, and the sequences were compared among the different populations of dogs.

In order to deduce relationships among the different populations, we used the sequences of the mitochondrial DNA to generate a phylogenetic tree. This tree represents the evolutionary relationships among the different populations, with the length of the branches indicating the time elapsed since they diverged from a common ancestor.

Discussion:

The results of the DNA analysis showed that the domesticated dogs in our study did not come from different wolf lineages. Instead, all of the domesticated dogs appeared to have descended from a single lineage of wolves. This conclusion is supported by the fact that all of the domesticated dogs in our study shared a common mitochondrial DNA haplotype, which is indicative of a common ancestry.

Our results are consistent with the hypothesis that domesticated dogs originated from a single population of wolves that was domesticated by early human populations. This process of domestication likely took place in a single location, and the domesticated dogs were then dispersed to other areas of the world.

The methods used in this study were effective in determining the relationships among different populations of domesticated dogs. By using DNA analysis and phylogenetic tree construction, we were able to deduce the evolutionary relationships among the different populations, and draw a conclusion about the origin of domesticated dogs.

Conclusion:

In conclusion, the results of our study indicate that all domesticated dogs came from the same wolf lineage, and not from multiple lineages as previously thought. The methods used in this study were effective in deducing the relationships among different populations of dogs, and the results provide new insights into the origins of domesticated dogs.

a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? mrna splicing formation of new transcription factors dna replication rate translation rate

Answers

A single-stranded RNA genome from a recently discovered virus is used as mRNA after infection. The translation rate method is the one that should be used to study how this virus replicates in a host cell. The correct answer is option(c).

The genome is the whole set of DNA demands in the direction of a container. In persons, the genome resides of 23 pairs of chromosomes situated in the container's core, in addition to a limited chromosome in the container's mitochondria. A genome holds all the new wanted for an individual to expand and function.

The rate of DNA translation changes contingent upon the type of creature. Prokaryotes can turn DNA at 21 amino acids per second, while eukaryotes interpret at a rate of 9 amino acids per second. It was found that the following visage was equated accompanying translation rate: codon habit commonness, few gene knowledge advancement scores, number of RNA binding proteins popular to bind allure mRNA amount, systematize series distance, protein affluence, and 5′UTR free strength.

To know more about genome refer to: https://brainly.com/question/29598514

#SPJ4

The complete question is:

A newly identified virus has a single-stranded RNA genome that is used as mRNA after infection. Its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. Which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell?

A) DNA replication rate

B) mRNA splicing

C) translation rate

D) formation of new transcription factors

options: dominant, recessive some, all

Answers

Answer: dominant

Explanation:

the theory that mitochondria and plastids originated from prokaryotic cells engulfed by a host cell is

Answers

The theory that mitochondria and plastids originated from prokaryotic cells engulfed by a host cell is known as: endosymbiotic theory.

Prokaryotic cells the primitive type of cells that do not have a well-defined nucleus. Instead they have a nucleus like structure called nucleoid. The genetic material lies openly as an aggregate on the cytoplasm and is also devoid of any cell organelles.

Mitochondria is the double membranous cell organelle of eukaryotes. The inner membrane is folded into various finger-like projections called cristae that increase the surface area of the organelle. The function of mitochondria is to synthesize ATP for the body requirements.

To know more about prokaryotic cells, here

brainly.com/question/18348786

#SPJ4

Other Questions
a teacher implements a reward system so that students will pay more attention in class. this describes which of the main goals of psychology? the regression equation y equals negative 0.414 x plus 106.55 approximates the percent of people in an audience who finish watching a documentary, y, given the length of the film in minutes, x. which percent is the best prediction for the percent of people in an audience who will finish watching a documentary that is 85 minutes long? Americans are diverse in all the following ways EXCEPT: a. coming from different backgrounds.b. thinking of themselves as Americans.c. being different ages.d. speaking different languages. a certain gas occupied a volume of 35cm^3 at -20. what will be it's temperature when it's volume is 50cm^3 pressure being constant Choose the correct graph for the inequality 3x 3y < 6. The graph shows a solid line, which passes through a point negative 2 comma 0 and a point 0 comma negative 2, with shading above the line. The graph shows a solid line, which passes through a point negative 2 comma 0 and a point 0 comma negative 2, with shading below the line. The graph shows a dashed line, which passes through a point negative 2 comma 0 and a point 0 comma negative 2, with shading above the line. The graph shows a dashed line, which passes through a point negative 2 comma 0 and a point 0 comma negative 2, with shading below the line. based on mr. van essen's clinical presentation and these assessment findings, does mr. van essen have signs of hemodynamic compromise? An 65 kg Olympic runner leaps over a hurdle . The acceleration of gravity is 9.81m/s^2 if the runner initial vertical speed is 2.8 m/s, how much will the runners center of mass be raised during the jump In studying the business law, students also review ethics in a business context. Ethics includes the study of what constitutes.a. right or wrong behavior.b. financially rewarding behavior.c. legal behavior.d. religious behavior. david, shannon, and greg are starting a new accounting firm together, and they are drafting articles of partnership. all of the following are items they should include except what were the companys predetermined overhead rates in the molding department and the fabrication department? american artist, jenny holzer's word work, installed in the guggenheim museum, 1989 - 1990 is an example of . you throw a rubber duck straight into the air and let it fall back down before you catch it. describe the direction of the velocity and acceleration vectors during the motion for the rubber duck. group of answer choices velocity and acceleration vectors will point in opposite directions for the whole motion. velocity and acceleration vectors will point in the same direction for the whole motion. velocity and acceleration will point in the same direction until the rubber duck falls back towards you. then, both vectors will then point in opposite directions. acceleration is zero for the whole motion. velocity and acceleration will point in opposite directions until rubber duck falls back towards you. then, both vectors will then point in the same direction. what does running out of shampoo and conditioner mean Required Information Ch02 AICPA Attestation Standards (Part 1 of 2) [LO2-6, LO2-7 AICPA Attestation Standards (Part 1 of 2) Read the overview below and complete the activities that follow Generally accepted auditing standards were adopted by the AICPA to provide guidance for the performance of audits. As these standards expand, the profession has developed more general attestation standards, contalned in SSAE No. 1 In addition to the auditing standards, a CPA firm should establish adequate quality control policies and procedures to provide reasonable assurance that it follows professional standards on every engagement. To that end, the AICPA has issued sbX elements to quality control standards to provide CPA firms with guidance In establishing quality control policies CONCEPT REVIEW: The attestation standards are meant to serve as a general framework and to set general boundaries for the attest function, while the quality control standards provide CPA firms with guidance in establishing quality control policies Part 1 - Drag and Drop Click and drag each of the below attestation standards to its correct type (general/standards of fieldwork/standards of reporting). The report must identify the subject Practitioner must have adequate technical Adequate planning, assistance matter and character of the audi training and atest function proficieney and supervision is required The report must state the conclusion of the practitioner Subject matter of engagement must be able to be evaluated Practitioner must have adequate knowledge in subject matter General Fieldwork Reporting Help!! Question in pic the nurse is caring for a patient who has been in a motor vehicle accident. the patient has been diagnosed with pleurisy. what is the preferred treatment for pain caused by pleurisy? Which of the following environmental health disasters does NOT correctly identify the toxic exposure?Select one:a. Bhopal, India - isocyanatesb. Minamata Bay, Japan - mercuryc. Woburn, Massachusetts - organic chemicals in drinking waterd. Love Canal, New York - contaminated fish from the Great Lakes 2. The option used for making books and magazines. computer topic 1.) A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a trait that shows simple dominance over Rh negative and is designated by the alleles R and r, respectively. Which of the following is a possible genotype for the father?2.) A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a trait that shows simple dominance over Rh negative and is designated by the alleles R and r, respectively. A third gene for the MN blood group has codominant alleles M and N.If both children are of blood type M, list all of the possible parental phenotypes 13. Which of the following is an example of deductive reasoning?Alex is a good musician, therefore his sister must be a good musician too.The picture is above the desk. The desk is above the floor. Therefore, the picture is above the floor.An orange is a fruit. An orange grows on a tree. All fruit grows on trees.