Some desirable characteristics of your chosen germicide include: - Rapid action even at low doses. - Long-term stability and solubility in water or alcohol. - Broad-spectrum microbicidal activity that is not harmful to human or animal tissues.
Germicide. A chemical agent that kills microorganisms is defined. Disinfectants and antiseptics are two examples. Definition: a chemical agent that kills hazardous germs while remaining selectively poisonous enough to be used on human skin. Germicides are classified into two types: a. Antiseptic: are germicides used on live surfaces? a. Disinfectants: These are often applied to the surface of inanimate objects and kill all pathogenic microorganisms except spores.
1-A
2-C
3-B
4-D
5-E
Learn more about germicide
https://brainly.com/question/13052271
#SPJ4
subliminal processing refers to the way in which consumers can be influenced without their brains sensing exposure to any kind of stimuli. (True or False)
The term "subliminal processing" describes how customers can be persuaded without their brains registering any exposure to stimuli. false.
A subliminal stimulus is a type of stimulus that, although it may be detected & processed in the brain, does not cause consciousness of perception, according to psychological study. A recipient of the a subliminal stimulus, for example, could be able to sense it but not necessarily be aware of it. The term "subliminal processing" describes how the human brain detects weak stimuli, or stimuli that happen below the threshold of conscious consciousness. Consumer exposure to and awareness to marketing stimuli is the first step in the perceptual process, which concludes with consumer interpretation. Reality and how customers perceive it are frequently extremely different
Learn more about brain
https://brainly.com/question/2664243
#SPJ4
which of the following is NOT true of ATP
A.) The hydrolysis of ATP is an exergonic process
B.) Energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, NOT from the phosphate bond itself
C.) ATP has less potential energy than ADP
D.) the release of a phosphate in ATP hydrolysis is often used to do exergonic work of a cell
The energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, and not from the phosphate bond itself. ADP has less potential energy than ATP. Thus, the correct options are B and C.
What is ATP hydrolysis?ATP hydrolysis is the catabolic reaction process through which the chemical energy that has been stored in the high-energy phospho-anhydride bonds in the ATP (adenosine triphosphate) is released after the splitting of these bonds, for example in the muscles, by producing work in the form of mechanical energy.
Energy from the hydrolysis of ATP is an exergonic process. This energy from ATP hydrolysis comes from the phosphate bond itself. ADP has less potential energy than ATP.
Therefore, the correct options are B and C.
Learn more about ATP here:
https://brainly.com/question/14637256
#SPJ1
in the following list, choose all that are considered complex tissues. multiple select question. xylem periderm sclerenchyma phloem epidermis parenchyma
According to the given lists xylem, phloem, and periderm are considered complex tissues.
Complex tissues are containing various types of cells, that is asserted. These tissues function as administering tissues as well as various types of cells agree as a part. These tissues are also known as vascular tissues as the correct vascular bundles. It is a somewhat fabric that is to say containing in addition to individual types of cells, and so forth the cells coordinate to act an average function. It resides in parenchyma and sclerenchyma cells. The names of a few complex tissues are the xylem and phloem.
The xylem and phloem are famous as complex tissues as they are containing as well individual types of cells. The complex fabric present in the xylem and phloem is vascular fabric. It is an attending fabric. Its main function searches to conduct or transport fluid and vitamins from individual parts to other parts of the plant.
To know more about xylem refer to: https://brainly.com/question/14197052
#SPJ4
the theory that mitochondria and plastids originated from prokaryotic cells engulfed by a host cell is
The theory that mitochondria and plastids originated from prokaryotic cells engulfed by a host cell is known as: endosymbiotic theory.
Prokaryotic cells the primitive type of cells that do not have a well-defined nucleus. Instead they have a nucleus like structure called nucleoid. The genetic material lies openly as an aggregate on the cytoplasm and is also devoid of any cell organelles.
Mitochondria is the double membranous cell organelle of eukaryotes. The inner membrane is folded into various finger-like projections called cristae that increase the surface area of the organelle. The function of mitochondria is to synthesize ATP for the body requirements.
To know more about prokaryotic cells, here
brainly.com/question/18348786
#SPJ4
options: dominant, recessive some, all
Answer: dominant
Explanation:
referring to environmental factors that affect genes and genetic expression; enhancing, halting, shaping, or altering the expression of genes, resulting in a phenotype that may differ markedly from the genotyp
Environmental factors that affect genes and genetic expression are known as epigenetic influences.
These influences can interact with the genetic code to enhance, halt, shape, or alter the expression of genes, resulting in a phenotype (observable physical characteristics) that may differ markedly from the genotype (the underlying genetic code).
Epigenetic changes can be caused by a variety of environmental factors, including nutrition, toxins, stress, and behavior.
These changes can occur in response to specific stimuli, such as changes in diet, exposure to toxins, or stress, and can then be passed down from one generation to the next, allowing an organism to adapt to its environment.
To learn more about epigenetic influences
https://brainly.com/question/29036896
#SPJ4
the structure indicated by the letter e controls equilibrium by receiving sensory information from all the following areas except the
By receiving sensory data from every Oculomotor nerve, the structure denoted by the letter "e" regulates equilibrium.
The third cranial nerve, or oculomotor nerve (CN III), is one instance where the name clearly identifies the nerve's purpose (oculo = relating to the eye, motor = creating movement). Therefore, it is clear just by looking at the name that the oculomotor nerve will innervate muscles that move either the entire eye or specific parts of the eye. The nerve's ability to produce movement is what makes it a useful sign of brain damage.
All cranial nerves with motor capabilities will have their nuclei in either the brainstem or spinal cord as their place of origin (medulla, pons, or midbrain).
know more about cranial nerves here
https://brainly.com/question/30431228#
#SPJ4
FILL IN THE BLANK within hours after conception, the first 23 pairs of chromosomes within the zygote ______, forming two complete sets of the genome.
Within hours after conception, the first 23 pairs of chromosomes within the zygote duplicate, forming two complete sets of the genome.
This process is called DNA replication, and it ensures that each daughter cell will receive a full chromosomes of genetic information. During replication, the DNA molecule unzips, and each strand serves as a template for the synthesis of a new zygote complementary strand. This is chromosomes by the addition of nucleotides, the building blocks of DNA, by the enzyme DNA polymerase. The process of replication is semi-conservative, zygote meaning that each daughter cell will receive one old strand and one new strand. This duplication of genetic information is essential for the proper development of the zygote into a viable organism, as it allows for the chromosomes of cells with identical genetic material, which can then differentiate and specialize to perform specific functions.
Learn more about zygote here:
https://brainly.com/question/26087722
#SPJ4
A product that maintains a large market share in the industry even though that industry does not have a high growth rate is considered to be a _______.
A product that maintains a large market share in the industry even though that industry does not have a high growth rate is considered to be a Cash cow.
Products with a sizable market share in a sector with slow growth rates are referred to as cash cows in the BCG matrix59. Within the BCG matrix, the VHS tape would be categorized as a DOG since it belongs to a product category where no company has a sizable market share and where the growth pace has essentially stopped.
In business parlance, a cash cow is an enterprise that consistently produces earnings that are significantly higher than the capital expenditure needed to launch or buy it. Since these enterprises can be utilized to increase a company's overall revenue and to support less profitable initiatives, many organizations try to establish or acquire them.
know more about Cash cow here
https://brainly.com/question/16818101#
#SPJ4
Which of the following DNA sequences must be found in a prokaryotic cell for transcription to be possible? (hint: what molecules are important for transcription?) (Choose ALL correct answers)Select all that applyA gene encoding rRNAA promoterA gene encoding the sigma proteinA gene encoding the RNA polymerase protein
The DNA sequences must be found in a prokaryotic cell for transcription to be possible in a promoter.
Thus, the correct option is B.
The process of trаnscription begins when аn enzyme cаlled RNА polymerаse (RNА pol) аttаches to the templаte DNА strаnd аnd begins to cаtаlyze production of complementаry RNА. Polymerаses аre lаrge enzymes composed of аpproximаtely а dozen subunits, аnd when аctive on DNА, they аre аlso typicаlly complexed with other fаctors. In mаny cаses, these fаctors signаl which gene is to be trаnscribed.
The first step in trаnscription is initiаtion, when the RNА pol binds to the DNА upstreаm (5′) of the gene аt а speciаlized sequence cаlled а promoter. In bаcteriа, promoters аre usuаlly composed of three sequence elements, whereаs in eukаryotes, there аre аs mаny аs seven elements.
Your options aren't well arranged, but most probably your options were
a. A gene encoding rRNA
b. A promoter
c. A gene encoding the sigma protein
d. A gene encoding the RNA polymerase protein
Thus, B is the correct option is B.
For more information about DNA transcription refers to the link:
https://brainly.com/question/12386
#SPJ4
plant mass actually comes from
Answer:
One of the earliest experiments to determine the answer to this question was performed by van Helmont in the 1600s. He planted a 2 kg willow tree in a sealed pot that contained 90 kg of dried soil. He watered the pot with rainwater. After five years, he found that the willow weighed 77 kg while only 60 grams of soil were missing. He concluded that the added weight of the plant arose out of the water. [1]
In light of our knowledge of photosynthesis, we know that the weight added is due to both atmospheric carbon dioxide and water. What's interesting is that John Woodward discovered that more than water contributed to the mass of the plant in 1699.[2] About 100 years later, in 1796, Senbier showed that carbon dioxide was utilized by plants in photosynthesis. In 1797, de Saussure demonstrated that both carbon dioxide and water, along with light, are required for plants to gain mass. [3], [4]
So in the end, we (mostly) add mass via
nCO2+nH2O+light→(CH2O)n+nO2
(CH2O)n can be utilized in many forms. For example, cellulose is a polysaccharide formed from many units of glucose C6H12O6 linked together.
Photosynthesis does account for most of the mass that is added within a plant. Of course, there are other important nutrients that plants need. One of the most important is magnesium, which is at the centre of the chlorophyll molecule. These other nutrients come from the soil.
Explanation:
≤hope it helps≥Which of the statements below best explains why a peptide would not react with phenylisothiocyanate? a) The peptide is lacking in methionine, the only amino acid which reacts with phenylisothiocyanate. b) The peptide is too small, only peptides larger than 50 residues in length react with phenylisothiocyanate. C) The peptide is circular and thus has no free N-terminal residue. d) The peptide is denatured. Denatured peptides do not react with phenylisothiocyanate.Â
Answer: A
Explanation:
blood types are classified on the basis of the presence of three antigens, called thea, b, and rh antigens. for example
Red blood cells with blood group A antigens from the ABO system and anti-B antibodies. plasma anti-A antibodies and blood group B antigens. A and a B antigens are present in blood group AB, but there are no antibodies.
Red blood cells' inherited characteristics are based on the presence or absence of antigens A and B, which are carried on their surface, and are used to categorise human blood according to the ABO blood group system. As a result, individuals may well have type A, type B, type O, as well as type AB blood. Red blood cells with blood group A antigens from the ABO system and anti-B antibodies. plasma anti-A antibodies and blood group B antigens. A and a B antigens are present in blood group AB, but there are no antibodies.Transmembrane proteins called Rh antigens, also known as Rhesus antigens, are expressed on the surface of erythrocytes.
Learn more about blood
https://brainly.com/question/17890844
#SPJ4
Spillage is a problem associated with which of the following types of mining?
Responses
surface mining
fracking
sub-surface mining
drilling
Spillage is a problem associated with drilling
What is drilling of oil?Drilling for oil is the process of creating a well to extract petroleum from underground reservoirs. The process begins with the selection of a suitable site, usually based on geological data, aerial surveys, and seismic studies. Next, a rig is constructed and equipment is brought to the site to drill the well.
The extracted oil is then transported to a processing facility for refining and distribution. Drilling for oil is a complex and expensive process, but it is essential for meeting the world's growing energy needs.
Learn more about oil drilling:https://brainly.com/question/29752686
#SPJ1
which of the following is an example of something jane goodall observed during her research on chimpanzees?
Jane Goodall's famous research on chimpanzees is a classic example of naturalistic observation.
What was Jane Goodall's research about?
Jane Goodall was the first person to observe chimpanzees creating and using tools—a trait that, at that time, was thought to be distinctly human. This discovery changed the way that we understand both animals and ourselves.
When the chimp pulled the leaves back out, Jane saw the gleam of water. The chimp then put the wet leaves back in its mouth. might automatically infer that she got a good grade. Inferences are not always correct, however.
Jane Goodall is an expert on wild chimpanzees. Recognized for her ground breaking discoveries about their behavior – she discovered that chimpanzees make tools, eat and hunt for meat, and have similar social behavior to humans.
Learn more about Jane Goodall's:
https://brainly.com/question/16544618
#SPJ1
which of the following structural features of e. coli is most responsible for the signs and symptoms of a urinary tract infection?
The flagella of Escherichia coli (E. coli) are the most responsible for the signs and symptoms of a urinary tract infection.
Flagellum is referred as a motility organelle which enables the movement and chemotaxis. Bacteria have one or several flagella which can be either polar or peritrichous.
A flagellum is defined as a hairlike appendage which comes from certain plant and animal sperm cells. They from a wide range of microorganisms to provide motility.
The flagella permits the bacterium to move and occupy the bladder which causes inflammation and infection. This results in symptoms such as pain or burning during urination, frequent urge to urinate, cloudy or strong-smelling urine, and lower abdominal pain.
To know more about flagella refer to-
brainly.com/question/13452834#
#SPJ4
Complete question
Which structural features of e. coli is most responsible for the signs and symptoms of a urinary tract infection?
A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicated DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? O The chemical disrupts hydrogen bonding. O The chemical inhibits DNA ligase. O The chemical blocks DNA polymerase. O The chemical prevents the formation of RNA primers.
The evidence is strongest in favour of the chemical's claim that it inhibits DNA ligase.
These strands are split apart in the replication process. Semiconservative replication is the process by which each strand of a original DNA molecule is used as a template to create its counterpart. RNA polymerase starts the transcription process with the aid of the sigma factor. 2. In prokaryotes, RNA polymerase also helps the leading strand—a continuously synthesised strand—open the DNA double helix. It's more difficult to use the other new strand, that also extends 5 to 3 feet from the fork. Because the DNA polymerase must separate as the fork advances and then reattach on the exposed DNA, this strand is created in fragments.
(A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicate DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). 5' -3' TAOGGCGTTAGACAAGTGCGTGAGTA CACA ATGCCGCAATстаттCACGCACTCATGTGT 3' 11 TL5' Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? (A) The chemical prevents the formation of RNA primers. (B) The chemical inhibits DNA ligase. (C) The chemical blocks DNA polymerase. The chemical disrupts hydrogen bonding.)
Learn more about DNA
https://brainly.com/question/264225
#SPJ4
magnesium reacts with oxygen to produce magnesium oxide calculate the percentage mass of magnesium in magnesium oxide relative atomic mass mg= 24 relative formula mass mgO=40
Answer:
24÷40×100%=60%
Explanation:
divide atomic mass by relative mass the multiply by 100%
Which of the following substances can diffuse across only sinusoid capillaries and not other capillaries?
a) plasma proteins
b) glucose
c) insulin
d) amino acids
Only sinusoid capillaries are capable of facilitating the diffusion of plasma proteins substances.
Plasma proteins, also known as blood proteins, are the proteins found in blood plasma. They perform a variety of tasks, such as lipid, hormone, vitamin, and mineral transport, immune system activity, and immune system functioning.
The liquid component of whole blood is called plasma. Plasma is whole blood devoid of erythrocytes, leukocytes, and platelets (RBCs, WBCs). Plasma without fibrinogen makes up serum, which is occasionally mistakenly thought to be synonymous with plasma. It consists primarily of:
Coagulants, particularly fibrinogen, help blood clot.The colloidal osmotic pressure is kept at a level of about 25 mmHg by plasma proteins like albumin and globulin.Calcium, sodium, potassium, bicarbonate, chloride, and other electrolytes all help to maintain blood pH.Immunoglobulins and various other minor amounts of enzymes, hormones, and vitamins aid in the fight against infection.Learn more about ' Immune System ' visit here;
https://brainly.com/question/19843453
#SPJ4
a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? mrna splicing formation of new transcription factors dna replication rate translation rate
A single-stranded RNA genome from a recently discovered virus is used as mRNA after infection. The translation rate method is the one that should be used to study how this virus replicates in a host cell. The correct answer is option(c).
The genome is the whole set of DNA demands in the direction of a container. In persons, the genome resides of 23 pairs of chromosomes situated in the container's core, in addition to a limited chromosome in the container's mitochondria. A genome holds all the new wanted for an individual to expand and function.
The rate of DNA translation changes contingent upon the type of creature. Prokaryotes can turn DNA at 21 amino acids per second, while eukaryotes interpret at a rate of 9 amino acids per second. It was found that the following visage was equated accompanying translation rate: codon habit commonness, few gene knowledge advancement scores, number of RNA binding proteins popular to bind allure mRNA amount, systematize series distance, protein affluence, and 5′UTR free strength.
To know more about genome refer to: https://brainly.com/question/29598514
#SPJ4
The complete question is:
A newly identified virus has a single-stranded RNA genome that is used as mRNA after infection. Its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. Which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell?
A) DNA replication rate
B) mRNA splicing
C) translation rate
D) formation of new transcription factors
figure 2: summary of the resolution and time span of record for proxy data sources. the top horizontal axis indicates the period for which the proxy data can be collected (e.g., tree rings can provide information on the climate for periods of hundreds to thousands of years). the bottom horizontal axis indicates the resolution available for the proxy data (e.g., tree rings provide annual resolution of the climate). drag the appropriate items into their respective bins. each item may be used only once.
Proxy data sources are data obtained from physical, chemical or biological materials that are indirect indicators of climate conditions.
The resolution of the proxy data refers to the level of detail it provides, e.g. annual or decadal. The time span of the record indicates the period of time for which the proxy data can provide climate conditions information, e.g. hundreds to thousands of years. The combination of the time span and resolution of the record allows scientists to reconstruct past climate conditions. For example, tree rings provide a high resolution of annual information for periods of hundreds to thousands of years. Other examples of proxy data sources include ice cores, sediment layers and pollen.
Learn more about climate conditions here:
https://brainly.com/question/19127146
#SPJ4
The complete Question is:
What is the purpose of Figure 2 and how does it summarize the resolution and time span of record for proxy data sources?
Leukocytes displaying red cytoplasmic granules when treated with Wright's stain are most likely ________.
A. basophils
B. erythrocytes
C. eosinophils
D. monocytes
Leukocytes displaying red cytoplasmic granules when treated with Wright's stain are most likely eosinophils (C)
Eosinophils are a type of white blood cell that helps the body fight against infections. This situation almost always points to either an infection caused by a parasite, an allergic reaction, or malignancy. Blood eosinophilia refers to an abnormally high number of eosinophils in the blood, while excessive levels of eosinophils in the tissues at the site of an infection or inflammation are known as tissue eosinophilia.
Eosinophils are often the largest type of granulocyte that can be seen in healthy blood. The cytoplasm of these organisms is often colorless or a light blue. On the other hand, the big granules that are present almost always serve to conceal the hue. Because they have absorbed the acidic components of the Wright stain, these granules have taken on a reddish orange color.
To learn more about eosinophils, click here:
https://brainly.com/question/10688608
#SPJ4
Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color, and find that 68% answered Brown. 1. What is the population? all people in the country [ Select] 2. What is the sample? [Se all people in the country 2500 people all people who use hair color 3. What is the variable here? [ Select] 4. List possible data values. [Select ] 5. The parameter of interest is [Select ] > 6. The statistic computed is [Select ]
The term "population" refers to all citizens who are either permanently residing in a country or who are just passing through.
This indicator reveals how many people typically reside in a certain location. Growth rates are indeed the population changes that occur each year as a result of births, deaths, and net migration. Changing the colour of one's hair is known as "hair colouring" or "hair dyeing." The primary explanations for this are aesthetic: restore the original hair colour after it has been faded by hairstyling procedures or sun bleaching, hide grey or white hair, or alter to a hue seen to be more trendy or attractive. Population refers to the total amount of people residing in a specific location at any one moment.
(Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color. Identify the population a. people who color their hair b.all women call individuals in the country d. all adult males in the country)
Learn more about population
https://brainly.com/question/21654221
#SPJ4
Use the drawling tools to form the correct answer on the graph.
Graph the line that represents this equation: y+2 = 1/2 (x+2)
The graph for the line that represents this equation: y+2 = 1/2 (x+2) is attached.
What is a line?It should be noted that a line is a one-dimensional shape that is straight, has no thickness, and extends in both directions indefinitely. The equation of a line is given by,
y =mx + c
where,
x is the coordinate of the x-axis,
y is the coordinate of the y-axis,
m is the slope of the line, and
c is constant.
In this case, the graph of the line y +2 = 1/2 (x + 2), can be drawn as is shown below.
Learn more about graph on:
https://brainly.com/question/24115285
#SPJ1
If a cell does not need a particular protein at a given time, which of the following strategies will require use of the least energy/resources (be the most energy/resource efficient) compared to the others? (Choose the ONE best answer)
Do not transcribe the mRNA from the gene encoding this protein.
A pre-mRNA molecule is created during transcription by the enzyme RNA polymerase II, which is then processed to create mature mRNA. A gene's DNA acts as a model for complementary base pairing.
If a gene is not transcribed in a cell, it cannot be used to make a protein there. A gene's transcription will almost certainly result in the production of a protein (expressed). The more a gene is transcribed, the more protein will typically be produced.
Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the information necessary for protein synthesis.
Learn more about " mRNA " to visit here;
https://brainly.com/question/12903143
#SPJ4
introduction of iron and functions of iron in the human body
Iron is a chemical element with the symbol Fe and atomic number 26. It is a metal that is essential for human health and is involved in many biological processes in the human body. Some of the key functions of iron in the human body include:
Oxygen Transport: Iron is a critical component of hemoglobin, a protein in red blood cells that carries oxygen from the lungs to the tissues throughout the body.Energy Metabolism: Iron is involved in various metabolic processes that produce energy for the body, including the production of ATP.Enzyme Function: Iron is a cofactor for several enzymes that are involved in various metabolic reactions.Immune Function: Iron is essential for the normal function of the immune system, including the production of white blood cells.Brain Development: Iron is important for proper brain development, especially in infants and children.It's important to have enough iron in the diet to maintain good health. However, too much iron can be harmful, so it's important to consult a doctor before taking iron supplements.
Hope my answer helps you!
question mode fill in the blank question fill in the blank question. leukopoiesis involves three different types of maturation processes______; maturation, maturation, and lymphocyte maturation.
Granulocyte maturation, monocyte maturation, and lymphocyte maturation are three separate types of maturation processes that are involved in leukopoiesis. Myeloid stem cells create monocytes and granulocytes. A lymphoid stem cell is the source of lymphocytes.
Leukocytes' (WBC's) course of development of leukopoiesis is the process through which leukocytes are produced.
The process of creating leukocytes (white blood cells) from pluripotent bone marrow hematopoietic stem cells. There are two important processes that generate different types of leukocytes: myelopoiesis, in which blood leukocytes are derived from myeloid stem cells, and lymphopoiesis, in which lymphoid stem cells give rise to lymphocytes.
Learn more about leukocytes here: https://brainly.com/question/822519
#SPJ4
The mechanism by which evolution occurs is called:
A, Creationism
B, Natural selection
C, Lamarckism
D, Metabolism
E, Artificial selection
Answer:
it is called natural selection
Answer:
natural selection (b)
Explanation:
It is well known that the main driving forces of evolution in any population are mutation, natural selection, genetic drift, and gene flow. The ability of these driving forces to perform their role is dependent on the amount of genetic diversity within and among populations.
a species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. which of the following will be true of this species' response to natural selection?
Option A, A species that has evolved an asexual mode of reproduction by having unfertilized eggs will likely have a slower response to natural selection compared to sexually reproducing species.
Asexual reproduction does not involve the exchange of genetic material through sexual recombination. As a result species, asexual populations tend to have less genetic diversity, which can make it more difficult for the population to adapt to changes in the natural selection environment. In sexually reproducing species, new combinations of genes can arise through sexual recombination, providing a greater pool of genetic diversity that can be acted upon by natural selection. This can allow sexually reproducing species to more rapidly evolve in response to environmental changes.
Learn more about natural selection here:
https://brainly.com/question/23929271
#SPJ4
The complete Question is:
A species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. Which of the following will be true of this species' response to natural selection?
(a)-There will be less genetic variation from recombination and a risk of not adapting quickly to environmental change.
(b)-The species will increase in numbers because genetic variation is increased.
(c)-There will be fewer deaths from natural selection because sexual recombination always leads to extinction.
(d)-There will be more deaths from natural selection because there is no mutation.
(e)-The species will compensate for loss of genetic variation by hybridizing with other species.
Which of the following statements are true about double-stranded DNA? a. A+C=T+G b. A+G=C+T c. A+T=G+C d. A/G = C/T e. A/G = T/C f. (C+A)/(G+T)=1
statements true about double-stranded DNA are a. A+C=T+G b. A+G=C+T e. A/G = T/C . it consists of two polynucleotide chains.
An rapid repair is required for DNA double-strand breaks (DSBs), which are cytotoxic lesions. A DSB can be repaired by a number of metabolic processes that have emerged. Gene conversion is one of the least error-prone methods for repairing a DNA double-strand break (DSB). Although this is the case, gene conversion is associated with a nearly 1000-fold rise in mutation rate. Gene conversion is not only linked to increased mutation rates, but also to more specific mutation profiles when compared to spontaneous mutation occurrences. Extremely frequent frameshift mutation events and other complicated alterations that are not present during typical DNA replication are characteristics of gene conversion.
learn more about double-stranded DNA here
https://brainly.com/question/15082078
#SPJ4