Hillsdale and Cordera are the same distance from the equator, and both are near the ocean. Is Cordera warmer, colder, or the same temperature as Hillsdale? Explain why as completely as you can.

Answers

Answer 1

Answer:

it is expected that Hillsdale and Cordera have nearly similar temperatures.

Explanation:

In the first place, it is important to note that there is an inverse relationship between latitude and temperature: temperatures are typically warmer near the Equator (lower latitudes) and cooler near the poles (higher latitudes). This phenomenon is due to the fact that the angle of solar radiation is smaller at higher latitudes, and thereby less solar radiation is received/absorbed near the poles than at the Equator. Moreover, another important factor that also determines the temperature is altitude: at higher altitudes, the temperature is lower. This phenomenon is due to the fact that at higher altitude air molecules spread out further, and therefore the temperature decreases. In consequence, at the sea level, the temperature is higher than at higher altitudes.


Related Questions


One Multiple Choice (A, B, or C) question and one True/False question.
For probability and permutations and combinations

Answers

what’s the questions ?

The Moon completes one orbit around the Earth in approximately
in approximately
and completes one cycle of its phases
A 271/3 days, 24 hours
B 24 hours, 24 hours
C 24 hours, 29 1/2 days
D 27 1/3 days, 29 1/2 days

Answers

Answer:

Answer is D

Explanation:

Takes about then to circle the Earth

Answer:

It takes 27 days, 7 hours, and 43 minutes

Explanation:

Type a paragraph describing how the circulatory and respiratory systems work together to deliver oxygen to the body’s tissues and remove carbon dioxide.
i. Include the names of structures and other components that play a role in gas
exchange.
ii. Explain how the interactions between the circulatory and respiratory systems
contribute to maintaining homeostasis in the body.
b) Type a second paragraph comparing the accuracy of your model to actual organ systems and
their functions.
i. Consider how a model is different from an actual human body.
ii. Describe the limitations of a model

Answers

Answer:

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

The circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

How circulatory and respiratory system work together?

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in to bring oxygen and out of the lungs to remove carbondioxde gas from the body. Blood moves into the lungs to bring carbondioxide gas and to load oxygen with the help of pumping of heart.

So we can conclude that circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

Learn more about system here: https://brainly.com/question/14323743

A student examines a periodic table.
Which inferences about sodium (Na) are true?

Answers

Answer:

true c this is the answer

Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion

Answers

Answer:

Secretion

Explanation:

Not completely sure tho, good luck

A child has a mass of 30 Kg on earth. If the gravity on the Moon is one sixth that of the earth what is the mass of the child moon

Answers

Answer:

30 kilograms

Explanation:

A change in gravity does not affect mass.

Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.

Answers

Answer:

D. Meiosis ensures a wider variety of genetic variation.

This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.

Plzz help
Determine the proper number of chromosomes that would be found in a human cell at each stage of the cell cycle.

Answers

Answer:  The genetic material of the cell is duplicated during S phase of interphase just as it was with mitosis resulting in 46 chromosomes and 92 chromatids during Prophase I and Metaphase I. However, these chromosomes are not arranged in the same way as they were during mitosis.

Explanation:

why is this conversion of energy from one molecule to another necessary for all cells?

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the energy conversion

=> ATP can be used to store energy for future reactions or be withdrawn to pay for reactions when energy is required by the cell.

=> When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

Why do we care how strong a rock is?

Answers

Answer:

hahahahahahahaha

Explanation:

because

Answer:

to throw it at ur cheating bf

Explanation:

lma.o

  °   •  .°•    ✯

   ★ *     °      °·                            

.   • ° ★ •  ☄

▁▂▃▄▅▆▇▇▆▅▄▃▁▂

what happens to most solar radiation when it gets to earth??

Answers

Answer:

Most of the solar radiation is bounced off of earth´s atmosphere.

Explanation:

Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.

White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?

Answers

Answer:

Lysosome

Explanation:

list the planets from smallest to largest

Answers

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter

Explanation:

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter.

Explanation:

hope this helps!!!:)

Multiple Choice
A student observed bees flying between flowers on a squash vine. after researching this activity, the student learns that bees obtain nectar from the flowers. The pollen from the flowers sticks to the bees and is transported to another flower of the same species, resulting in pollination. The student decides this is an example of mutualism. Which table explains why this relationship is mutualism?

Answers

Answer:

The answer is D

Explanation:

Flowers and bees both benefit from pollination so D

Answer: that should be d

Explanation:

What are the two most common sources for rivers and streams?

Answers

Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:I did this in class 2 days ago LOL

Answer:

The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:

Hope this helped you :D

Why do we not use a Punnett Square to determine the offspring for asexual reproduction? Is that form of reproduction diverse? Explain your answer.

Answers

Answer: There isn’t another organism to cross with

Explanation:

In asexual reproduction there is only one parent so all the genes come from one person.

What percentage of Americans use solar power ?

Answers

Answer:

66.7 percent.

Explanation:

I looked it up and nothing rly said what percentage of Americans use solar power but solar power was used for 2.30% of the total US electricity.

Which of the following is true about the role of genetic and environmental factors in human health?
A) Genes are the only factor affecting whether or not an idividual will contract a disease.
B) Genetic factors are more important than environmental factors in determining an individual's
personal health risks.
C) Individuals can influence their health by controlling their genetic traits.
D) Environmental factors determine whether or not all genetic traits lead to health issues.
E) Certain environments can lead to an increased risk of developing certain diseases.

Answers

Answer:

E) Certain environments can lead to an increased risk of developing certain diseases.

Explanation:

The lesson states that specific environments can increase the chance of health problems.

scientific and common name for this?

Answers

Answer:

The common name for this is Moss

Scientific name is Bryophyta

Explanation:

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Answers

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

SCIENCE ASSAP PLS
what does secondary succession mean in science

Answers

secondary succession is when plants and animals recolonize a habitat after a major ecological disturbance

Why do we want to produce genetically different organisms?

Answers

Answer: Genetically engineered crops produce higher yields, have a longer shelf life, are resistant to diseases and pests, and even taste better.

Explanation:

Everything I think produce organs I think

What happens to chromosomes when an ovum and a sperm meet at fertilisation

Answers

Answer: When egg and sperm cells combine in fertilizations, they merge the two sets of chromosomes, ending up with 46 chromosomes in total. The maternal chromosomes from the egg cell and the paternal chromosomes from the sperm cell pair up. The resultant cell is called a zygote. Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.

Explanation:

2. Write the complementary DNA strand: (1 points)
CTT GAC TGA TGC

Answers

GAA CTG ACT ACG is the answer
GAA CTG ACT ACG
pretty sure this is right

During cellular respiration, energy is transferred from *
1 point
A. ATP to glucose
B. CO2 to enzymes
c. sunlight to glucose
D. glucose to ATP

Answers

Answer:

a or b I'm sorry but I know it's not c

Answer:

A? im not sure..................

How does natural selection lead to the evolution of a species?

Answers

Answer:

One of these is natural selection, which is a process that increases the frequency of advantageous gene variants, called alleles, in a population. Natural selection can result in organisms that are more likely to survive and reproduce and may eventually lead to speciation.

Explanation:

When a species evolves, it can get more repellent and tougher to what kills them off. For exp, if a animal can’t survive due to a carried disease, it will eventually evolve to be stronger against it.

What is the meaning of the term metabolism?

Answers

Metabolism is the chemical processes that occur within a living organism in order to maintain life. Have a good day! Also, any answer that says, ‘Here is the link to your answer: (link)’ DO NOT CLICK ON IT!!

A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong

Answers

A plant produces seed cones and pollen cones. Belong to plant group
phylum Coniferophyta and Yes it is vascular

A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.

What are gymnosperms?

Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.

Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.

Find out more about gymnosperms here.

https://brainly.com/question/15158870

#SPJ2

Are enzymes needed for metabolism?
A. YES!
B. NO!
C. MAYBE SO!

D. ALL OF THE ABOVE (This option clearly makes no sense! Don't pick it!)​

Answers

A.

Enzymes break down food

Answer:

YES! (Don't mean to yell, but those were the options.)

Explanation:

Enzymes break down food, and therefore, are needed for metabolism.

Archie Carr helped save turtles from extinction. What did he do during Operation Green Turtle?
A.) He made laws against hunting turtles.
B.) He took turtle eggs to safe beaches.
C.) He cleaned the turtles after an oil spill.
D.) He planted grasses that turtles eat.

Answers

Answer:B

Explanation:The project distributed green turtle eggs and hatchlings to various nesting beaches around the Caribbean and the Gulf of Mexico in an effort to encourage the growth of their dwindling populations. His conservation efforts also led him to lead campaigns against ocean pollution.

Other Questions
What is the source of most salt in the ocean?A.fishB.human activity C. WindD. Rocks on land ABC with vertices A(-3,-3), B(6,3), and C(6,-9) is dilated by a scale factor of 1/3 from the origin. What are the coordinates of A'? * the field was an important basis for feudalism because it was what Solvex +6> 10,x + 16>20,x + 26 > 30. Complete the description of a pattem. Then use the pattern topredict the solution of x + 4 446 > 4,450.For each Inequality, x> ( ) and the number added to x Is ( ) less than the number on theright side of each inequality. So,X> ( ) is the solution of x + 4,446 > 4,450. In an advertisement, a statement by a user about the benefits he or she received is called a _____.A.testimonialB.storyboardC.unique selling propositionD.visual element 9. Madeline and Jonathan want to purchase a home in six years. They will contribute $540 every six months to a savings account with 5.25% Interest, compounded quarterly. What is the futurevalue of this Investment, when Madeline and Jonathan need to make a down payment? (4 points)O $7,559.06O $15,118.11$7,502.45$7,658.27 You have 0.531 L of gas in a container. What is the volume in mL? Billy wants to find out which cafeteria food is the favorite in his school for students. He surveys 100 students. 29 students select sub sandwiches, 35 select steak and gravy, and 36 select fried chicken. if you select one of these students. What is the probability it will be a student who prefers chickenAnswer choicesA. 7/20B. 9/25C. 40%D.29/100 What are the solutions to the following equation?[m] = 8.5The value of m is equal to 8.5 andbecause each distance from zero is 8.5. Jefferson is plotting the vertices of an isosceles right on a coordinate graph. he has plotted the two points shown. Where should he plot the third point? geometry, can u help???? Please help The perimeter of a quadrilateral is 336.The ratio of the sides is 2: 3: 2: 5. Findthe side lengths. can someone plz help me A table of values of a linear function is shown below. Find the output when the input is n. Type your answer in the space provided. Can someone please help me pleaseeee! please help 13 points how many significant digits in 8.90 Given the following historical demand and forecast, calculate the Mean Absolute Percentage Error: Week 1 Demand: 50 Forecast: 49 Week 2 Demand: 54 Forecast: 50 Week 3 Demand: 58 Forecast: 63 FE = D-F n FE RSFE RSFE = 27=1 FE; MFE = n n (FE;) 21-1|FEil MSE = MAD = n n FE; 2i=1 =FE TS = RSFE MAPE n MAD MAD about 6.0% A. about 2.0% B. about 18.0% C. about 4.3% D. about 1.00% Which of the following correctly sequences the events in Vietnam? IT'S AIT'S A THIS ONE France refused to grant independence; H.o Chi Minh won at Dien Bien Phu; Vietnam was divided at the 17th parallelVietnam was divided at the 17th parallel; H.o Chi Minh won at Dien Bien Phu; France refused to grant independenceH.o Chi Minh won at Dien Bien Phu; Vietnam was divided at the 17th parallel;France refused to grant independence which of the following is correct statement about this relation?