Explain the causes and effects of westward expansion from 1844 to 1877.

Answers

Answer 1

Answer:

The desire for access to natural and mineral resources and the hope of many settlers for economic opportunities or religious refuge led to an increased migration to and settlement in the West

Explanation:

Answer 2

The causes of the Westward expansion includes the following:

The people wanted to be closer to the state of California which was known to have gold resources.They had the opportunity due to the homestead act to acquire land at cheap costs.The manifest destiny that said that the whites were destined by God to own all the lands in the area.The cities that were in the East had become too expensive and crowded for some people,

The effects of the Westward expansion includes the following:

It led to tensions between the South and the north of the US.It led to an increase of immigrants into the US from Mexico.It led whites to take over the lands of the Native Americans.It brought about a multi cultural society

Read more on https://brainly.com/question/18828059?referrer=searchResults


Related Questions

Which of the following campaigns/battles led to the Ally defeat of the Axis
Powers?

Answers

Answer:

Tunisian campaign and the Italian campaign

Explanation:

Answer:

Battles of El-Alamein, (1–27 July 1942, 23 October—11 November 1942), World War II events. After the First Battle of El-Alamein, Egypt (150 miles west of Cairo), ended in a stalemate, the second one was decisive. It marked the beginning of the end for the Axis in North Africa

Normandy Invasion, also called Operation Overlord or D-Day, during World War II, the Allied invasion of western Europe, which was launched on June 6, 1944 (the most celebrated D-Day of the war), with the simultaneous landing of U.S., British, and Canadian forces on five separate beachheads in Normandy, France.

Explanation:

This is a very hard questions answer as WWII had many important battles as the Allies strive to defeat the Axis. Sorry, if this answer is not exactly what you wanted.

Drag and drop the description to match each person into the boxes. Lord Cornwallis
Nathanael Greene
Alexander Hamilton
William Howe
Martha Washington
George Rogers Clark .Frontiersman who fought British and their Indian allies in Ohio valley. .Commander of British ship Serapis and said "I have not yet begun to fight." .Quartermaster general of the Continental Army; brought caches of food and supplies to Valley Forge and led troops in the South. .Commander of all British forces in America until 1778. .General's wife who helped boost morale at Valley Forge. .American colonel and aide to Washington who captured a key British earth fortress at Yorktown. pls help 50 points!!!!

Answers

Answer:

1.) George Rogers Clark (Frontiersman who fought British and their Indian allies in Ohio valley.)

2.) Lord Cornwallis (Commander of British ship Serapis and said "I have not yet begun to fight.")

3.) Nathanael Greene (Quartermaster general of the Continental Army; brought caches of food and supplies to Valley Forge and led troops in the South.)

4.) William Howe (Commander of all British forces in America until 1778.)

5.) Martha Washington ( General's wife who helped boost morale at Valley Forge.)

6.) Alexander Hamilton (American colonel and aide to Washington who captured a key British earth fortress at Yorktown.)

Explanation:

Hope that helps. Also I always go to quizlet for more help

https://quizlet.com/2098304/american-revolution-flash-cards/

To what was the ancient Egyptian writer referring in this hymn?

The pharaoh

The Nile river

The sun God, Re

The Giza pyramid

Answers

Answer:

The sun God, Re

Explanation:

hymn means song and or poem that is praised to God or a god.

Which position is appointed at the county level?
a. prosecuting attorney and county judge
b. county judge and medical examiner
c. medical examiner and prosecuting attorney
d.medical examiner and sheriff

Answers

B. Country judge and medical examiner

Who would have most likely NOT supported the Freedmen's Bureau?
A)
A western farmer.
B)
A newly freed slave.
A former slave owner.
D)
A northern abolitionist.

Answers

Answer:

A

Explanation:

because their opposites

Your answer would be A.



Have a good day !

Explain how the development of the steam engine and the Erie Canal played a significant role in the development of the United States, specifically New York City.

Answers

Answer:

It aloud goods to be transported further faster and less of a chance of being looted in doing so

Explanation:

Explain how the spread of Christianity hurt the Roman Empire.

Answers

Answer:

change of religion

Explanation:

thats what caused harm

Rome began to fall and they blamed Christians and romans began to turn on them . years of Roman tradition were thrown away. Under Constantine's rule, Pagan temples were abolished and the wealth was appropriated.

How did Islam affect northern and eastern Africa? Use at least two examples from your reading.
whoever gets asnwer clearly and correct gets:thanks,rating 5.and brainliest.

Answers

Answer:

Explanation:

The religion of Islam arose in the Arabian city of Mecca around A.D. 610 through the work of its prophet Muhammad. After Muhammad died in 632, his teachings were carried into Africa by Arab traders, settlers, and soldiers. By conversion and conquest, Islam spread across North Africa, into the eastern Horn of Africa, and even over the SAHARA DESERT into West Africa. The arrival of Islam had a major impact on the political and social development of those regions, and it remains a significant force in Africa today.

THE SPREAD OF ISLAM

Islam first took hold on the continent in the 600s and 700s. It was brought to EGYPT and North Africa by conquering armies and to the East African coast by traders and merchants. West Africa did not encounter Islam until about 800, and the religion spread more slowly there than in the eastern part of the continent.

Islam in Africa

Egypt, Sudan, and Ethiopia

In 639 an Arab army of some 4,000 men invaded Egypt, which was then under the control of the Byzantine Empire. Despite its small size, this Muslim force succeeded in driving the Byzantines out of Egypt and installing their own ruler, known as emir. Soon afterwards the Arabs began to push south along the NILE RIVER, attacking the Christian kingdoms of NUBIA in what is now northern SUDAN. However, Nubian resistance halted the Arab advance, and in 651 the emir of Egypt signed a peace treaty with the Nubians.

Answer: Islam was popular in the cities of northern and eastern Africa but had less impact in the countryside. Mansa Musa of Mali made his country known to other parts of the world when he set out on a journey to Mecca in 1324. In East Africa, Swahili culture combined traditional African influences with Islamic influences. Islam impacted African concepts of right and wrong, introduced Arabic to many Africans, advanced learning, and influenced art and architecture.

Explanation: i just did it

How did The Crisis influence African American authors?

Answers

Answer:

it encouraged the african American authors

what does khrushchev accuse kennedy of using to get what he wants?

Answers

answer b on edge got it right

Answer:

a: starting a war

no

Explanation:

how did the war change relationships between Imperial powers and colonies​

Answers

well i mean there are a few different ways

Explanation:

Answer:

demostracted fragile positions. had witnessed not just the mobilistation of conoial societies and resources but also the mobilisation of new ideas on the nature of imperial rule and international relations

Explanation:

In 1762 a German-born princess named Empress ____________________blank came to the throne. She promoted ____________________blank ideas and fostered the arts.

Answers

Answer:

In 1762 a German-born princess named Empress Catherine the Great or Catherine II came to throne. She promoted Enlighted ideas and fostered the arts.

Explanation:

The first blank is Catherine the Great/Catherine II

The second blank is Enlighted

Hopefully this helps

Why were so many Americans anxious to get married and start families in the late 1940's and the 1950's?

Answers

Answer:

Many were anxious that the cost of living was going up at the very time they were trying to find new jobs. thoes that found jobs found prices rising faster then their wages. they would not be able to pay the bills or afford the consumer goods they need

what was the unoffical motto of the son of liberty

Answers

Answer:

no taxation without representation

Explanation:

No person shall...be deprived of life, liberty, or property, without due process of law.” How would this amendment sound if it described the way things really were?

Answers

Answer:

Very mixed opinions

Explanation:

It depends on the person, while some would believe that this is true, others would think that it is deserved depending on what they did (ex: murder)

also, some might find offensive depending on how they have been treated for particular/no reason.

so while some would believe its fine others wouldn't.

In what way was Africa impacted by the Great Depression

Answers

Answer:

African peasants were deeply affected by the steep fall in agrarian prices caused by the worldwide Depression of the 1930s. The export of African produce was controlled by large European trading companies, and a few major ports provided the channels through which such exports had to pass.

Explanation:

Answer:

African colonies were exploited by their European colonizers in an attempt to save European economies.

Explanation:

The answer has been confirmed!

I have taken the PF Exam already—it is correct!

You can find me on Quizlet (kennedyanne82) for any help that you need regarding Penn Foster.

helpppp
The Confederation Congress had grave financial difficulties during and
after the Revolutionary War because of all of the following EXCEPT
a. It was deeply in debt to foreign areditors
b. It owed barely in debt to foreign creditors
c. It was saddled with a crushing war debt
d. It could not tax or impose trade duties

Answers

Answer: B

Explanation: Hope This Helped.

can someone please give me a paragraph and a half of research on the Navajo Indian code talkers of ww2 i will give brainliest answer as well.

Answers

Answer:

A code talker is the name given to American Indians who used their tribal language to send secret communications on the battlefield. Most people have heard of the famous Navajo (or Diné) code talkers who used their traditional language to transmit secret Allied messages in the Pacific theater of combat during World War II. But did you know that there were at least 14 other Native nations, including the Cherokee and Comanche, that served as code talkers in both the Pacific and Europe during the war? The idea of using American Indians who were fluent in both their traditional tribal language and in English to send secret messages in battle was first put to the test in World War I with the Choctaw Telephone Squad and other Native communications experts and messengers. However, it wasn’t until World War II that the US military developed a specific policy to recruit and train American Indian speakers to become code talkers. The irony of being asked to use their Native languages to fight on behalf of America was not lost on code talkers, many of whom had been forced to attend government or religious-run boarding schools that tried to assimilate Native peoples and would punish students for speaking in their traditional language.

The US Army was the first branch of the military that began recruiting code talkers from places like Oklahoma in 1940. Other branches, such as the US Marines and Navy, followed a few years later, and the first class of 29 Navajo code talker US Marine recruits completed its training in 1942. Apart from basic training, these men had to develop and memorize a unique military code using their mostly unwritten language, and were placed in a guarded room until this task was completed.

The first type of code they created, Type 1 code, consisted of 26 Navajo terms that stood for individual English letters that could be used to spell out a word. For instance, the Navajo word for “ant,” wo-la-chee, was used to represent the letter “a” in English.

Type 2 code contained words that could be directly translated from English into Navajo, and the code talkers also developed a dictionary of 211 terms (later expanded to 411) for military words and names that didn’t originally exist in the Navajo language. For example, since there was no existing Navajo word for “submarine,” the code talkers agreed to use the term besh-lo, which translates to “iron fish.”

Explanation:

How did television change the nature of political communication

Answers

The power of conviction that television exerts on voters during an election campaign can become decisive in the triumph or defeat of a particular party or candidate, since for a very large number of citizens it is the only source of information. This mass media supports electoral campaigns, through informative programs and free advertising spaces for political parties.

Answer: The way in which the invention of television changed the nature of political communication was that it gave the public the ability to to see what officials looked like and see the effects of their actions. The correct option among all the options that are given in the question is the second option or option "B".

Explanation: How did the invention of television change the nature of political communication? A) It made other forms of media like newspapers and the radio obsolete in terms of spreading a message. B) It gave the public audience the ability to see what officials looked like and see the effects of their actions. C) It caused people to spend more time consuming entertainment programming rather than political events. D) It led to the creation of regulatory agencies that prevent news stations from taping public officials' speeches.

What was a Northern objection to the Kansas-Nebraska Act?
A. It forced slave owners who traveled to those areas to free their
slaves.
B. It said that those two areas would have to allow slavery.
C. It forced Northerners to help return slaves who had escaped to
freedom.
D. It made it possible for slavery to be allowed in more areas.

Answers

Answer: D.) It made it possible for slavery to be allowed in more areas.

Explanation: The Kansas-Nebraska Act allowed the states to choose whether or not they want to become free or slave states. After the Missouri Compromise was repealed by the Kansas-Nebraska act, Northerners were angry that the states were allowed popular sovereignty.

Answer: D.

Explanation:

it made it possible for slavery to be allowed in more areas

How many presidents oversaw the conflict with Vietnam?

Answers

Answer: 5

Explanation:

Answer:5 I THINK AM I CORRECT

Explanation:

____________ is an example of an invasion that took place that changed national boundaries.
A.
The American Revolution
B.
Napoleon building an empire
C.
The Mexican-American War
D.
The Louisiana Purchase

HAPPY PEOPLE IM HOT THEY ARE DELETING MY QUESTIONS;(

Answers

Answer:

C) the Mexican American war I am 100% sure

Explanation:

I think it is the C) Mexican -American War

True or False: Great Britain only made money by importing
resources and goods from Africa, and not by exporting goods to
Africa.

Answers

I think the answer is true

Write a word or phrase describing the significance of Clara Barton and the role of nurses in the Civil War

Thank You !



Have a Good Night or Day

Answers

Answer:

Inspiring, Motivating, Caring

Explanation:

I would say those are some words to describe her

NEED HELP PLZ ASAP

1. Based on the map, what was the northernmost city from which children were evacuated?


Answers

Answer:

I believe it is Newcastle.

How does the Medici family pick a wife for Lorenzo?

Answers

Wanted a women from a Nobel family to enhance the social status of the Medici

NEED IN ! MINETUTE

Which of the following BEST explains the significance of the Miranda v. Arizona trial of 1966?
A.
It proved that state court systems were inherently faulty.
B.
It resulted in the release of many convicted kidnappers.
C.
It ignited a battle between state supreme courts and federal supreme courts.
D.
It resulted in the creation of Miranda Rights, a statement that all police must read to suspects.

Answers

Answer:

D

Explanation:

your welcome

How did Catherine the great type of monarchy affect her nation ?

Answers

Answer:

As empress, Catherine westernized Russia. She led her country into full participation in the political and cultural life of Europe. She championed the arts and reorganized the Russian law code. She also significantly expanded Russian territory.

Explanation:

Hope This Helps !!!!!!!!!!!

Who called for “massive resistance” by southern politicians to the Brown decision?
Earl Warren
Harry Byrd
Orval Faubus
Thurgood Marshall

Answers

Earl Warren called for the massive resistance all the others weren’t apart of it !

Earl Warren called for “massive resistance” by southern politicians to the Brown decision. Hence, option A is correct.

What did Chief Justice Earl Warren say?

Warren, arguing for the court, declared that "separate educational facilities are intrinsically unequal," rejecting the "separate but equal" principle that had been upheld since Plessy v. Ferguson in 1896.

The court then urged the desegregation of public schools with "all deliberate speed." In the unanimous decision Brown v. Board of Education (1954), which overturned Plessy v. Ferguson (1896), he urged his fellow judges to follow his lead.

This decision marked the end of segregation in American culture and sparked the civil rights movement and other modern campaigns for reform.

Thus, option A is correct.

For more information about Chief Justice Earl Warren say, click here:

https://brainly.com/question/29547848

#SPJ6


What Caused the Great Depression?

Answers

Answer:

hello and bye

Explanation:

It began after the stock market crash of October 1929, which sent Wall Street into a panic and wiped out millions of investors. Over the next several years, consumer spending and investment dropped, causing steep declines in industrial output and employment as failing companies laid off workers.

Other Questions
Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9} Read this sentence from paragraph 2 of "Puzzle Solved"Solving this thing is as easy asslaying Medusa!Why does Anya compare the cryptogram to slaying Medusa?A It is difficult to conquerOB. It is based on mythologyoc. It is not what it seems.OD. It is hard to look at.