Estimate the specimen size below if the low power lens was used. The circle indicates the field of view. 1.8 mm
0.9 mm 90 um 180 um

Answers

Answer 1

180 um would be the deemed specimen size. A specimen is a piece of matter, an organism, or some other object that has been taken for scientific investigation.

Typically, specimens are utilized in testing, research, and teaching settings. Biological samples like blood, tissue, and cells as well as inanimate items like rocks, minerals, and fossils are examples of specimens. The size of the specimen and the lens's power are inversely proportional. Less lens power is required to see a specimen the larger it is. In contrast, a stronger lens is required to observe a specimen that is smaller in size.

To know more about specimen refer to the link below :

brainly.com/question/29348024

#SPJ4


Related Questions

The mechanism by which evolution occurs is called:

A, Creationism
B, Natural selection
C, Lamarckism
D, Metabolism
E, Artificial selection

Answers

Answer:

it is called natural selection

Answer:

natural selection (b)

Explanation:

It is well known that the main driving forces of evolution in any population are mutation, natural selection, genetic drift, and gene flow. The ability of these driving forces to perform their role is dependent on the amount of genetic diversity within and among populations.

Problem 7. A population, obeying the logistic equation, begins with 1000 bacteria, then doubles itself in 10 hours. The population is observed eventually to stabilize at 20,000 bacteria (i.e. the carrying capacity K = 20,000). Find the number of bacteria present after 25 hours and the time it takes the population to reach one-half of its carrying capacity.

Answers

The population of bacteria in 25hrs reach 5084 bacteris. The population  of bacteria reach 1.5 takes t (time) = 26.13 hrs to reach one-half of its carrying capacity.

A. For t = 25hrs,

P (25) = 20000 / (1+19 e^ (-2.5) ln (19 / 9)) = 5083.75

After 25 hrs, the population is 5084 Bacteria.

B. Find the time it takes to reach 1.5 of the carrying capacity.

=> (1.5) x (20,000) = 30,000 and

Recall: P(t) = 20000 / (1+19 e^ (- 2.5) ln (19 / 9) t)

Solve 30,000 = 20000 / (1+19 e^ (- 2.5) ln (19 / 9) t)        for t

=> 30,000 x (1+19 e^ (- 2.5) ln (19 / 9) t) = 20,000

=> 1+19 e^ (- 2.5) ln (19 / 9) t = 3/2

=> 19 e^ (- 2.5) ln (19 / 9) t = 1.5

=> e^ (- 2.5) ln (19 / 9) t = 1.5 / 19

Taking log both sides, we get

=> (- 2.5) ln (19 / 9) t = ln (1.5 / 19)

=> t = 26.1369 hrs  (Rounded to 4 decimal place)

It takes 26.13 hrs for the population to reach 1.5 its carrying capacity.

Bacteria are single-celled microorganisms that are found in virtually every environment on Earth. They play a vital role in the ecosystem, serving as decomposers, fixing nitrogen, producing antibiotics, and forming symbiotic relationships with other organisms. Bacteria are classified into two main groups, Gram-positive and Gram-negative, based on their cell wall structure. They can be found in soil, water, air, and in and on the human body.

Some bacteria can cause infections in humans, such as Staphylococcus aureus and Escherichia coli, while others are beneficial, such as those found in the gut which aid in digestion. Bacteria can be cultured in the laboratory for study and can also be engineered for industrial and agricultural applications. However, their ability to rapidly multiply and evolve can lead to the development of antibiotic-resistant strains, making it important to maintain proper hygiene and use antibiotics wisely.

To learn more about Bacteria visit here:

brainly.com/question/14314349

#SPJ4

identify functions of atp. multiple select question. to store information within the cell to accept electrons during oxidation-reduction reactions

Answers

The following are some examples of how ATP is used:

To drive transport through cellular membranes

To drive cellular motility

To trigger negatively energetic reactions.

The energy molecule known as adenosine triphosphate (ATP) is produced during the metabolic oxidation of glucose. These processes that make use of this ATP include:

Active transport: It supplies the force necessary to move things up or down a gradient of concentration. As a result, the materials are transported across cell membranes.

Cellular mobility is caused by ciliary movement and muscle contraction, both of which need energy from ATP hydrolysis to function.

Reaction that is thermodynamically unfavorable: This can be caused by a cell's hydrolysis of the ATP energy molecule.

To know more about ATP energy click here:

brainly.com/question/11455456

#SPJ4

FILL IN THE BLANK after about the eight-cell stage within the zygote, cells start to________, meaning that they take different forms and reproduce at various rates depending on where they are located.

Answers

Cells begin to differentiate, or take different forms and reproduce at different rates depending on where they are located after the zygote has about eight cells.

A zygote is a eukaryotic cell made by a breeding occurrence betwixt two gametes. The zygote's genome is an alliance of the DNA in each female reproductive cell and holds all of the ancestral news of a new individual structure. In multicellular structures, the zygote is the first enlightening stage.

The differentiation of cells all along embryogenesis is the key to cell, fabric, means, and creature similarity. Once a cell is fertilized by semen, a zygote is made. The zygote divides into diversified cells in a process popular as a gap, setting off the origin of rudimentary distinction.

To know more about zygote refer to: https://brainly.com/question/26087722

#SPJ4

A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicated DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? O The chemical disrupts hydrogen bonding. O The chemical inhibits DNA ligase. O The chemical blocks DNA polymerase. O The chemical prevents the formation of RNA primers.

Answers

The evidence is strongest in favour of the chemical's claim that it inhibits DNA ligase.

These strands are split apart in the replication process. Semiconservative replication is the process by which each strand of a original DNA molecule is used as a template to create its counterpart. RNA polymerase starts the transcription process with the aid of the sigma factor. 2. In prokaryotes, RNA polymerase also helps the leading strand—a continuously synthesised strand—open the DNA double helix. It's more difficult to use the other new strand, that also extends 5 to 3 feet from the fork. Because the DNA polymerase must separate as the fork advances and then reattach on the exposed DNA, this strand is created in fragments.

(A scientist adds a chemical to a culture of dividing cells in order to disrupt DNA replication. The replicate DNA produced by the cells is double-stranded, but sections of it lack covalent bonds between adjacent nucleotides (Figure 1). 5' -3' TAOGGCGTTAGACAAGTGCGTGAGTA CACA ATGCCGCAATстаттCACGCACTCATGTGT 3' 11 TL5' Figure 1. Replicated DNA produced after a chemical is introduced Which of the following claims is best supported by the data? (A) The chemical prevents the formation of RNA primers. (B) The chemical inhibits DNA ligase. (C) The chemical blocks DNA polymerase. The chemical disrupts hydrogen bonding.)

Learn more about DNA

https://brainly.com/question/264225

#SPJ4

Which of the following is a biotic factor? a) a predator b) a mountain range. c) phosphorus inputs. d) a stream. e) nitrogen inputs.

Answers

The following biotic factor is a predator.

Thus, the correct option is A.

The ecosystem comprises both biotic аnd аbiotic fаctors. The term “biotic” meаns “of or relаted to living orgаnisms”. Аn ecosystem consists of аll living orgаnisms аnd the physicochemicаl components.  Biotic fаctors include аll living orgаnisms present in the environment. It includes plаnts, аnimаls аnd microorgаnisms. А predаtor is аn orgаnism thаt cаptures аnd eаts аnother (the prey). This аct is cаlled predаtion.

In contrаst, the аbiotic components include the environmentаl fаctors like аir, wаter, soil, light, temperаture, mountain range, phosphorus inputs, stream, nitrogen inputs, etc.

For more information about biotic factors refers to the link:

https://brainly.com/question/34710

#SPJ4

magnesium reacts with oxygen to produce magnesium oxide calculate the percentage mass of magnesium in magnesium oxide relative atomic mass mg= 24 relative formula mass mgO=40

Answers

Answer:

24÷40×100%=60%

Explanation:

divide atomic mass by relative mass the multiply by 100%

fill in the blank.. scott and darpa are siblings who have the same parents. scott has heavy, straight eyebrows, whereas darpa has thinner, arched eyebrows. these differences in eyebrow shape are due to different___that each sibling received from their parents.

Answers

Option B is Correct. Each sibling inherited a different allele from their parents, which is the cause of these variations in brow shape.

The parents of Scott and Darpa are siblings. Darpa's eyebrows are smaller and arched, while Scott's are thick and straight.  A DNA sequence (a single base or a segment of bases) at a certain genomic region might have two or more variations, each of which is referred to as an allele. For any chromosomal region where such variation exists, a person inherits two alleles, one from each parent.

The person has homozygosity for that allele if the two alleles are identical. These various gene variants are referred to as alleles. A cytosine base-coding allele, for instance, may be one of two alleles present at a given locus.

Learn more about alleles Visit: brainly.com/question/23516288

#SPJ4

Correct Question:

Scott and Darpa are siblings who have the same parents. Scott has heavy, straight eyebrows, whereas Darpa has thinner, arched eyebrows. These differences in eyebrow shape are due to different _____ that each sibling received from their parents.

A) nurture

B) alleles

C) gender

D) advice

Option B is Correct. Each sibling inherited a different allele from their parents, which is the cause of these variations in brow shape.

The parents of Scott and Darpa are siblings. Darpa's eyebrows are smaller and arched, while Scott's are thick and straight.  A DNA sequence (a single base or a segment of bases) at a certain genomic region might have two or more variations, each of which is referred to as an allele. For any chromosomal region where such variation exists, a person inherits two alleles, one from each parent.

The person has homozygosity for that allele if the two alleles are identical. These various gene variants are referred to as alleles. A cytosine base-coding allele, for instance, may be one of two alleles present at a given locus.

To learn more about allele visit:

https://brainly.com/question/30507591

#SPJ4

which of the following is NOT true of ATP

A.) The hydrolysis of ATP is an exergonic process

B.) Energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, NOT from the phosphate bond itself

C.) ATP has less potential energy than ADP

D.) the release of a phosphate in ATP hydrolysis is often used to do exergonic work of a cell

Answers

The energy from the hydrolysis of ATP comes from the chemical change to a state of lower free energy, and not from the phosphate bond itself. ADP has less potential energy than ATP. Thus, the correct options are B and C.

What is ATP hydrolysis?

ATP hydrolysis is the catabolic reaction process through which the chemical energy that has been stored in the high-energy phospho-anhydride bonds in the ATP (adenosine triphosphate) is released after the splitting of these bonds, for example in the muscles, by producing work in the form of mechanical energy.

Energy from the hydrolysis of ATP is an exergonic process. This energy from ATP hydrolysis comes from the phosphate bond itself. ADP has less potential energy than ATP.

Therefore, the correct options are B and C.

Learn more about ATP here:

https://brainly.com/question/14637256


#SPJ1

Write a short (2 page) report that includes a Methods section and a Discussion of this data. In the Methods section, describe the data and how you would use them to deduce relationships among different populations. In the Discussion, draw a conclusion about whether domesticated dogs came from different wolf lineages, or all came from the same one. Use your experience with the simulated dogs in this lab to justify your methods and conclusions.

Answers

Report on Domesticated Dog Lineages

Introduction:

The origins of domesticated dogs have been a subject of much interest and study in the fields of genetics, animal behavior, and evolution. In order to understand the relationships among different populations of domesticated dogs, it is necessary to analyze DNA samples from a variety of dogs, including wild wolves and domesticated dogs. This report will describe the methods used to analyze the data, and discuss the results in order to draw a conclusion about the origin of domesticated dogs.

Methods:

Data was collected from DNA samples of domesticated dogs, wild wolves, and hybrid dogs that were generated from crosses between domesticated dogs and wild wolves. The DNA was extracted from the samples and analyzed using polymerase chain reaction (PCR) to amplify specific regions of the mitochondrial DNA. This amplified DNA was then sequenced, and the sequences were compared among the different populations of dogs.

In order to deduce relationships among the different populations, we used the sequences of the mitochondrial DNA to generate a phylogenetic tree. This tree represents the evolutionary relationships among the different populations, with the length of the branches indicating the time elapsed since they diverged from a common ancestor.

Discussion:

The results of the DNA analysis showed that the domesticated dogs in our study did not come from different wolf lineages. Instead, all of the domesticated dogs appeared to have descended from a single lineage of wolves. This conclusion is supported by the fact that all of the domesticated dogs in our study shared a common mitochondrial DNA haplotype, which is indicative of a common ancestry.

Our results are consistent with the hypothesis that domesticated dogs originated from a single population of wolves that was domesticated by early human populations. This process of domestication likely took place in a single location, and the domesticated dogs were then dispersed to other areas of the world.

The methods used in this study were effective in determining the relationships among different populations of domesticated dogs. By using DNA analysis and phylogenetic tree construction, we were able to deduce the evolutionary relationships among the different populations, and draw a conclusion about the origin of domesticated dogs.

Conclusion:

In conclusion, the results of our study indicate that all domesticated dogs came from the same wolf lineage, and not from multiple lineages as previously thought. The methods used in this study were effective in deducing the relationships among different populations of dogs, and the results provide new insights into the origins of domesticated dogs.

a species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. which of the following will be true of this species' response to natural selection?

Answers

Option A, A species that has evolved an asexual mode of reproduction by having unfertilized eggs will likely have a slower response to natural selection compared to sexually reproducing species.

Asexual reproduction does not involve the exchange of genetic material through sexual recombination. As a result species, asexual populations tend to have less genetic diversity, which can make it more difficult for the population to adapt to changes in the natural selection environment. In sexually reproducing species, new combinations of genes can arise through sexual recombination, providing a greater pool of genetic diversity that can be acted upon by natural selection. This can allow sexually reproducing species to more rapidly evolve in response to environmental changes.

Learn more about natural selection here:

https://brainly.com/question/23929271

#SPJ4

The complete Question is:

A species has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. Which of the following will be true of this species' response to natural selection?

(a)-There will be less genetic variation from recombination and a risk of not adapting quickly to environmental change.

(b)-The species will increase in numbers because genetic variation is increased.

(c)-There will be fewer deaths from natural selection because sexual recombination always leads to extinction.

(d)-There will be more deaths from natural selection because there is no mutation.

(e)-The species will compensate for loss of genetic variation by hybridizing with other species.

fill in the blank. ___ his studies of ice-polished rocks in his alpine homeland, far outside the range of present-day glaciers, led louis agassiz in 1837 to propose the concept of an age in which great ice sheets had existed in now currently temperate areas.

Answers

In areas that are now temperate in 1837 as a result of his statistical investigations of ice-polished rocks in his native alpine region, which is outside the current glacier range.

Show timer hidden Louis Agassiz proposed the idea of a period in which massive ice sheets had existed. Show timer statistics are hidden. Louis Agassiz proposed the idea of a period in which massive ice sheets had existed in areas that are now temperate in 1837 as a result of his research on ice-polished rocks in his Alpine homeland, well outside the range of modern glaciers.

The Antarctic ice sheet and the Greenland ice sheet are the only ice sheets left in existence today. However, during the most recent glacial epoch, ice sheets completely surrounded much of the planet.

Learn more about homeland Visit: brainly.com/question/16504850

#SPJ4

How can the organization of cells, tissues, organs, and organ systems in a multicellular organism be sequenced?

Answers

The level of organization in a multicellular organism begins with the individual cells. These individual cells form a tissue, and the tissues make up an organ. A group of organs forms an organ system, and in turn, these organ systems make up an organism.

What is an organism?

An organism is any living entity that is capable of carrying out essential life functions such as metabolism, growth, reproduction, and adaptation to its environment. Organisms can be single-celled or multi-celled, and they can be classified into different kingdoms, including bacteria, archaea, protists, fungi, plants, and animals. Each organism has unique characteristics that enable it to thrive in its particular environment. These characteristics can be genetic, physiological, anatomical, or behavioral. Organisms are important components of ecosystems, playing critical roles in maintaining the balance of natural systems and contributing to biodiversity.

To know more about organism, click the link given below:

https://brainly.com/question/12825206

#SPJ1

The organization of cells, tissues, organs, and organ systems in a multicellular organism can be sequenced using a combination of histology, imaging, molecular biology, developmental biology, and systems biology techniques.

What is organization of cells?

Organization of cells refers to the arrangement and structure of cells within an organism, which allows them to perform specific functions. In multicellular organisms, cells are organized into tissues, organs, and organ systems, each with a particular function and structure that contributes to the overall function of the organism. The organization of cells is essential for the proper functioning of the organism, as it allows for the coordination of different processes and the maintenance of homeostasis.

The organization of cells, tissues, organs, and organ systems in a multicellular organism can be sequenced using a variety of techniques. Here are some common approaches:

1. Histology: Histology studies the microscopic anatomy of cells and tissues. It involves the preparation of tissue sections, staining, and examination under a microscope. Histology can help to identify the different types of cells, tissues, and organs present in an organism.

2. Imaging: Imaging techniques such as X-ray, CT scan, MRI, ultrasound, and PET scan can provide a non-invasive way to visualize the internal structures of an organism. These techniques can be used to study the morphology and function of organs and organ systems.

3. Molecular biology: Molecular biology techniques such as PCR, DNA sequencing, and gene expression analysis can be used to study the molecular basis of cellular and tissue organization. These techniques can be used to identify the genes and proteins involved in the development and maintenance of different organs and tissues.

Therefore, a combination of these techniques can sequence the organization of cells, tissues, organs, and organ systems in a multicellular organism.

To learn more about the organization of cells click here

https://brainly.com/question/28542920

#SPJ1

question mode fill in the blank question fill in the blank question. leukopoiesis involves three different types of maturation processes______; maturation, maturation, and lymphocyte maturation.

Answers

Granulocyte maturation, monocyte maturation, and lymphocyte maturation are three separate types of maturation processes that are involved in leukopoiesis. Myeloid stem cells create monocytes and granulocytes. A lymphoid stem cell is the source of lymphocytes.

Leukocytes' (WBC's) course of development of leukopoiesis is the process through which leukocytes are produced.

The process of creating leukocytes (white blood cells) from pluripotent bone marrow hematopoietic stem cells. There are two important processes that generate different types of leukocytes: myelopoiesis, in which blood leukocytes are derived from myeloid stem cells, and lymphopoiesis, in which lymphoid stem cells give rise to lymphocytes.

Learn more about leukocytes here: https://brainly.com/question/822519

#SPJ4

Identify whether each of the following would result in the membrane potential becoming more positive or more negative.Match the appropriate change with each scenario. a) Increasing the concentration of K+ in the extracellular fluid. b) Decreasing the concentration of K+ in the extracellular fluid. c) Decreasing the number of leak channels for Na+ along the cellular membrane. d) Inserting more K+ leak channels into the cellular membrane. e) Increasing the concentration of Na+ in the extracellular fluid

Answers

The membrane is considered to be depolarized if the membrane potential shifts from being negative to being positive relative to the resting potential.

The membrane is referred to as being hyperpolarized if its potential is more negative than it is at its resting potential.

At a specific location on the neuron's membrane, hyperpolarization occurs when the membrane potential increases, Depolarization occurs when the membrane potential decreases (more positive).More favorably: There are three times as many Na+ leak channels and twice as much K+ outside of the cell.More detrimental Increase the amount of K+ leak channels while halving the amount of Na+ outside the cellEssentially unchanged Increasing the cell size by two without adding channels two times as many closed channels for K+.

Learn more about resting membrane Visit: brainly.com/question/12885791

#SPJ4

Correct Question:

For each of the following, indicate whether the condition will cause the membrane potential to become more positive, more negative, or largely unchanged when compared to the normal physiological resting membrane potential.

A. Double the size of the cell, without adding channels

B. Double the number of K+ leak channels

C. Triple the number of Na+ leak channels

D. Double the concentration of K+ outside the cell

E. Decrease the concentration of Na+ outside the cell by half

F. Double the number of closed channels for K+

professor marcus is studying gene expression in the liver cells of a mouse. she observes that when a steroid hormone enters the liver cells, the cells begin producing a wide variety of new proteins. which of the following statements is the most useful to include in an explanation of this observation?

Answers

The most useful statement to include in an explanation of Professor Marcus's observation is that steroid hormones can activate gene expression by binding to specific receptors in the liver cells, leading to the initiation of a series of molecular events that ultimately result in the production of new proteins.

This highlights the role of hormones in regulating gene expression, and the complex mechanisms by which they control cellular processes. It also emphasizes the importance of studying gene expression in understanding cellular and physiological processes.

The translation of messenger RNA (mRNA) into proteins is known to be modulated by steroid hormones, which include, among others, progestogen, oestrogen, glucocorticoid, and androgen.

It has been demonstrated that sex steroid hormones in mammals influence the expression of important genes, such as the prolactin gene needed for milk production.

To learn more about steroid hormones

https://brainly.com/question/29382368

#SPJ4

options: dominant, recessive some, all

Answers

Answer: dominant

Explanation:

subliminal processing refers to the way in which consumers can be influenced without their brains sensing exposure to any kind of stimuli. (True or False)

Answers

The term "subliminal processing" describes how customers can be persuaded without their brains registering any exposure to stimuli. false.

A subliminal stimulus is a type of stimulus that, although it may be detected & processed in the brain, does not cause consciousness of perception, according to psychological study. A recipient of the a subliminal stimulus, for example, could be able to sense it but not necessarily be aware of it. The term "subliminal processing" describes how the human brain detects weak stimuli, or stimuli that happen below the threshold of conscious consciousness. Consumer exposure to and awareness to marketing stimuli is the first step in the perceptual process, which concludes with consumer interpretation. Reality and how customers perceive it are frequently extremely different

Learn more about brain

https://brainly.com/question/2664243

#SPJ4

which of the following best predicts the effect of inserting this gene into the dna of a bacterial cell?

Answers

The expression of a gene, which results in the creation of a protein or other product encoded by the gene, can be induced by inserting a gene into the DNA of a bacterial cell.

Depending on how this protein or product performs, the cell may then be affected. The new gene would be inserted into the DNA sequence. The sequence would be altered specifically according to the gene and the intended position. The DNA sequence would be cut at that spot and the new gene would be spliced into it, for instance, if the gene had to be placed at a certain site in the DNA. As single-celled prokaryotic organisms, bacteria cells lack a nucleus and other organelles. They have a cell wall that aids in cellular protection and a cell membrane that controls what enters and exits the cell.

To know more about DNA refer to the link below :

brainly.com/question/264225

#SPJ4

figure 2: summary of the resolution and time span of record for proxy data sources. the top horizontal axis indicates the period for which the proxy data can be collected (e.g., tree rings can provide information on the climate for periods of hundreds to thousands of years). the bottom horizontal axis indicates the resolution available for the proxy data (e.g., tree rings provide annual resolution of the climate). drag the appropriate items into their respective bins. each item may be used only once.

Answers

Proxy data sources are data obtained from physical, chemical or biological materials that are indirect indicators of climate conditions.

The resolution of the proxy data refers to the level of detail it provides, e.g. annual or decadal. The time span of the record indicates the period of time for which the proxy data can provide climate conditions information, e.g. hundreds to thousands of years. The combination of the time span and resolution of the record allows scientists to reconstruct past climate conditions. For example, tree rings provide a high resolution of annual information for periods of hundreds to thousands of years. Other examples of proxy data sources include ice cores, sediment layers and pollen.

Learn more about  climate conditions here:

https://brainly.com/question/19127146

#SPJ4

The complete Question is:

What is the purpose of Figure 2 and how does it summarize the resolution and time span of record for proxy data sources?

Which of the following best describes when a protocol may be eligible for expedited review by the IRB?
a) The study includes only healthy research subjects.
b) The study does not require written consent.
c) The study involves no more than minimal risk and meets one of the allowable categories of expedited review specified by the federal government.
d) The study is required for a student research project.

Answers

Option c (The study involves no more than minimal risk and meets one of the allowable categories of expedited review specified by the federal government) best describes the condition when a protocol may be eligible for expedited review by the IRB.

Protection of Human Subjects in Clinical Trials and Institutional Review Boards (IRBs) | Food and Drug Administration When you see the.gov extension, you know it's legit.

The Institutional Review Board (IRB) is a committee inside the institution that is responsible for conducting ethical reviews of planned research involving human beings and monitoring ongoing research. In addition to this duty, the IRB is accountable for the provision of training pertaining to the protection of human research subjects.

IRB reviews can fall into one of the following categories: (a) exempt; (b) expedited; (c) full; (d) continuing; and (e) limited. The IRB is not required to conduct any monitoring for an exempt review.

Want to know more about IRB visit the link which is given below;

https://brainly.com/question/14275569

#SPJ4

which of the following compounds is not hydrophilic? proteins carbohydrates lipids nucleic acids water

Answers

The compound which is not hydrophilic is: lipids.

Hydrophilic refers to the property of a substance that has a strong affinity towards water. The molecules that have the affinity towards water are called hydrophile. The examples of hydrophiles are: carbohydrates, salts, amino acids, etc.

Lipid is an amphipathic molecule that has a hydrophilic head and a hydrophobic tail. It is a fatty acid that has several functions inside the living body. The most important function is in the synthesis of plasma membranes, which is made up of lipid bilayer. The other forms of lipids are: fat-soluble vitamins, monoglycerides, diglycerides, etc.

To know more about hydrophilic, here

brainly.com/question/13378292

#SPJ4

a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? a newly identified virus has a single-stranded rna genome that is used as mrna after infection. its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell? mrna splicing formation of new transcription factors dna replication rate translation rate

Answers

A single-stranded RNA genome from a recently discovered virus is used as mRNA after infection. The translation rate method is the one that should be used to study how this virus replicates in a host cell. The correct answer is option(c).

The genome is the whole set of DNA demands in the direction of a container. In persons, the genome resides of 23 pairs of chromosomes situated in the container's core, in addition to a limited chromosome in the container's mitochondria. A genome holds all the new wanted for an individual to expand and function.

The rate of DNA translation changes contingent upon the type of creature. Prokaryotes can turn DNA at 21 amino acids per second, while eukaryotes interpret at a rate of 9 amino acids per second. It was found that the following visage was equated accompanying translation rate: codon habit commonness, few gene knowledge advancement scores, number of RNA binding proteins popular to bind allure mRNA amount, systematize series distance, protein affluence, and 5′UTR free strength.

To know more about genome refer to: https://brainly.com/question/29598514

#SPJ4

The complete question is:

A newly identified virus has a single-stranded RNA genome that is used as mRNA after infection. Its capsid is 25-30 nm in diameter and contains 180 identical capsomeres. Which of the following processes would be the best to follow to analyze the reproduction of this virus in a host cell?

A) DNA replication rate

B) mRNA splicing

C) translation rate

D) formation of new transcription factors

using the plot, which statement explains why metabolism is regulated to keep the ratio [atp]/[adp] high?

Answers

Suppressed mitochondrial function leads to lower production of mitochondrial ATP and hence lower cytosolic ATP/ADP ratios that favor enhanced glycolysis.

Suppressed mitochondrial function leads to lower production of mitochondrial ATP and hence lower cytosolic ATP/ADP ratios that favor enhanced glycolysis. Thus, cytosolic ATP/ADP ratio is a key feature that determines if cell metabolism is predominantly oxidative or glycolytic.

The ATP:ADP ratio is a central control parameter of cellular energy metabolism that determines the free-energy change for ATP hydrolysis and therefore the driving force for many reactions1.

Breaking down glucose releases energy, which is captured by the cell in the form of adenosine triphosphate, or ATP. ATP is a small molecule that gives cells a convenient way to briefly store energy. Once it's made, ATP can be used by other reactions in the cell as an energy source.

The changes in ADP/ATP ratio have been used to differentiate the different modes of cell death and viability. Increased levels of ATP and decreased levels of ADP have been recognized in proliferating cells. In contrast, decreased levels of ATP and increased levels of ADP are recognized in apoptotic cells.

We are a comprehensive global provider of cloud-based human capital management (HCM) solutions that unite HR, payroll, talent, time, tax and benefits administration, and a leader in business outsourcing services, analytics and compliance expertise.

Learn more about glycolysis here:-

https://brainly.com/question/29604117

#SPJ4

What is the reason for the small number of electrons in the shell closest to the nucleus?

Answers

Each electron shell has a different energy level, with the electron shells closest to the nucleus having a lower energy level than those furthest from the nucleus.

Why does the electron shell nearest to the nucleus have the lowest energy?

Energy-level-varying electrons float about the atom. Orbitals and sub-orbitals make up energy levels. The distance between an electron and the nucleus increases with decreasing energy levels.

The nucleus has a greater number of protons than electrons, which increases the strength of the attraction between them. The electrons that are closer to the nucleus have less energy as a result. An electron is more stable and advantageously positioned in a shell that is closer to the nucleus than one that is further from the nucleus because the energy of the closest shells to the nucleus is typically lower than the energy of the farthest shells.

To know more about nucleus refer to:

https://brainly.com/question/5223117

#SPJ1

Dr.Griffin is treating a young couple who are having a child. The parents are worried that since the mo a carrier for the disorder of color blindness that the child will have color blindness as well. The father does not have color blindness. What are the chances that the child will NOT have color blindness? Use X for no color blindness and X for having color blindness
Pls helppp

Answers

The child has a 50% chance of having color blindness (Xc) and a 50% chance of not having color blindness (XX).

What is color blindness?

Color blindness, also known as color vision deficiency, is a condition in which an individual has difficulty seeing certain colors, or a reduced ability to distinguish between certain colors.

The chances of the child NOT having color blindness depend on the genetic makeup of the mother and the father. If the mother is a carrier of the color blindness gene (Xc), she has one normal allele (X) and one mutant allele (c). The father does not have color blindness, so he has two normal alleles (XX).

The chance of the child inheriting the normal allele from the mother is 50%. The chance of the child inheriting the normal allele from the father is 100%. Therefore, the overall chance of the child NOT having color blindness is 50% * 100% = 50%. This means that the child has a 50% chance of having color blindness (Xc) and a 50% chance of not having color blindness (XX).

Learn more about color blindness, here:

https://brainly.com/question/29807811

#SPJ1

Mice engineered with the OREXIN::UCP2 construct have a body weight that is ____________ the weight of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have a body temperature that is _____________ the temperature of wild type animals.the temperature of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have an activity level that is ____________ the activity level of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have a food intake level that is ____________ the food intake of wild type animals.
Mice engineered with the OREXIN::UCP2 construct have a life span that is ______________ the life span of wild type animals.

Answers

The body weight of mice created using the OREXIN::UCP2 construct is higher than that of animals of the wild type.

Weight is a calculation of the gravitational force on an object. It not only depends on the object's bulk but more on the allure district. Therefore, pressure is indeed a measure of force. In the United States, most population measure pressure in pounds.

Keeping your weight in the usual range is a fundamental part of healthful becoming older. As in additional stages of growth, raised body mass index (BMI) in earlier men can increase the possibility of expanding well-being questions. These contain coronary thrombosis, extreme ancestry pressure, stroke, and diabetes.

To know more about weight refer to: https://brainly.com/question/1658757

#SPJ4

Spillage is a problem associated with which of the following types of mining?

Responses

surface mining

fracking

sub-surface mining

drilling

Answers

Spillage is a problem associated with drilling

What is drilling of oil?

Drilling for oil is the process of creating a well to extract petroleum from underground reservoirs. The process begins with the selection of a suitable site, usually based on geological data, aerial surveys, and seismic studies. Next, a rig is constructed and equipment is brought to the site to drill the well.

The extracted oil is then transported to a processing facility for refining and distribution. Drilling for oil is a complex and expensive process, but it is essential for meeting the world's growing energy needs.

Learn more about oil drilling:https://brainly.com/question/29752686

#SPJ1

Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color, and find that 68% answered Brown. 1. What is the population? all people in the country [ Select] 2. What is the sample? [Se all people in the country 2500 people all people who use hair color 3. What is the variable here? [ Select] 4. List possible data values. [Select ] 5. The parameter of interest is [Select ] > 6. The statistic computed is [Select ]

Answers

The term "population" refers to all citizens who are either permanently residing in a country or who are just passing through.

This indicator reveals how many people typically reside in a certain location. Growth rates are indeed the population changes that occur each year as a result of births, deaths, and net migration. Changing the colour of one's hair is known as "hair colouring" or "hair dyeing." The primary explanations for this are aesthetic: restore the original hair colour after it has been faded by hairstyling procedures or sun bleaching, hide grey or white hair, or alter to a hue seen to be more trendy or attractive. Population refers to the total amount of people residing in a specific location at any one moment.

(Suppose you want to know what the predominant hair color in your country is. You survey a random sample of 2500 people in your country, asking them about their hair color. Identify the population a. people who color their hair b.all women call individuals in the country d. all adult males in the country)

Learn more about population

https://brainly.com/question/21654221

#SPJ4

Which natural methods remove CO2 from the atmosphere

Answers

photosynthesis removes carbon dioxide naturally — and trees are especially good at storing carbon removed from the atmosphere by photosynthesis.

Other Questions
possible remedies for a breach of contract include: compensatory damages. fines. incarceration. all of these. none of these. Why is AC power the power of choice for long distance power transmissions? HELP!!!Joe can type 40 words every 2 minutes. How many words can he type in 5 minutes? 4. El incendio ________ (destruir) un apartamento.*(preterit verb btw) utilize the following graph of the gasoline market to answer the following question: a question: suppose that initially the equilibrium price is $10 and equilibrium quantity is 20. now suppose that incomes decline. after the shift was there excess quantity demanded or excess quantity supplied? what molecule is the final acceptor of the electrons Simple diffusion of a molecule down its concentration gradient requires an input of energy to the system.TRUE or FALSE the porter five-forces model is designed to help us understand how social attitudes and cultural values impact u.s. businesses. group of answer choices true false under saturating agonist conditions, which functional state describes the nmdar conformation that has the lowest gibbs free energy? a. bound to agonists and impermeant to ions b. bound to agonists and permeant to ions c. unbound to agonists and permeant to ions d. unbound to agonists and impermeant to ions what has most likely happened if an animal is entrapped? use your knowledge of the latin prefix en- to help you answer. the formula for figuring interest expense is: multiple choice question. amount owed x years of useful life x number of days outstanding amount owed x interest rate x fraction of the year since last payment cost/years of useful life. T/F You have a ruler of length 2 and you choose a place to break it using a uniform probability distribution. Let random variable X represent the length of the left piece of the ruler. X is distributed uniformly in [0, 2]. You take the left piece of the ruler and once again choose a place to break it using a uniform probability distribution. Let random variable Y be the length of the left piece from the second break. Draw a picture of the region in the X-Y plane for which the joint density of X and Y is non-zero. Compute the joint density function for X and Y . (As always, make sure you write a complete expression.) Compute the marginal probability density for Y , fY (y). Compute the conditional probability density of X, conditional on Y = y, fX|Y (x|y). (Make sure you state the values of y for which this exists.) a client is diagnosed with a postpartum infection. the nurse is most correct to provide which instruction? 1. Origins of Words - State where the word originated from (region/country) and when its first known use was (time frame).2. Soundtrack - Create a soundtrack/famous song using each of the 10 vocabulary words, provide the song title and artist.3. Would You Rather? - Create questions of Would You Rather using all 10 vocabulary words.4. Clue - Generate clues that will help me guess which vocabulary word you are providing cluesfor.5. Color Blast - Associate each of the 10 vocabulary words with a color AND provide an explanation as to why vou made the association. (MARKING AS BRAIN-LIST 20 points!) question mode multiple choice question which of these statements explains the access online students have to learning resources? multiple choice question. while receiving a shift report on a patient, the nurse is informed that the patient has urinary incontinence. upon assessment, which finding will the nurse expect? how does population density and effect economic please help with question you are excitedly looking at potential job descriptions. you notice that all list a requirement of a degree, willingness to pursue an advanced degree, and licensure. service service social justice social justice integrity integrity competence competence Refer to the Figure given below. Without trade, Arturo produced and consumed 240 tacos and 120 burritos and Dina produced and consumed 100 tacos and 150 burritos. Then, each person agreed to specialize in the production to the good in which they have a comparative advantage and trade 260 tacos for 156 burritos. as a result, Arturo gains:a. 20 tacos and 24 burritos and Dina gained 40 tacos and 6 burritos,b. 20 tacos and 36 burritos and Dina gained 160 tacos and 6 burritos,c. 260 tacos and 144 burritos and Dina gained 140 tacos and 156 burritos,d. 260 tacos and 156 burritos and Dina gained 260 tacos and 156 burritos.