Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

Answer 1

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1


Related Questions

norganic nutrients that are NOT broken down by the human body or destroyed by heat or light are called

Answers

Minerals are not digested or broken down because they are already in their purest form. They are taken in whole, transported about the body for different purposes, and eventually expelled.

Despite being categorized as micronutrients, vitamins and minerals differ greatly from one another. Organic compounds like vitamins decay in the presence of heat, air, or acid. Minerals are inorganic materials having a consistent chemical composition.

Vitamin C and the B-complex vitamins B6, B12, and folate are examples of water-soluble vitamins that must dissolve in water in order to be absorbed by the body and cannot thus be stored. Any water-soluble vitamins that the body does not absorb are primarily excreted in urine.

Learn more about to inorganic nutrients;

https://brainly.com/question/14366476

#SPJ4

How do musical embellishments help enhance a piece of music?

Answers

Musical embellishments are decorative or ornamental elements that are added to a musical piece to enhance its emotional expression or to make it more interesting or appealing. There are many different types of musical embellishments, including trills, turns, mordents, and vibrato, and they can be used to add variety and interest to a piece of music.

Embellishments can help to bring out the melody or theme of a piece of music, adding emphasis and expression to certain notes or phrases. They can also help to add a sense of movement or flow to the music, creating a sense of momentum or momentum. Additionally, embellishments can help to create a sense of drama or tension, particularly when used in a strategic or expressive way. Overall, embellishments can help to enrich the emotional content of a piece of music and make it more engaging and enjoyable for the listener.

Under which of the following conditions will the lac operon be expressed at the highest level? a. Glucose and lactose present b. Glucose present, lactose absent c. Glucose absent, lactose present d. Glucose and lactose absent

Answers

Two requirements must be satisfied for the lac operon to express at high levels: There must be no glucose.

What does a high glucose level mean?

Because the body doesn't produce enough insulin, hypoglycemia (high blood glucose) occurs because there is too much sugar inside the blood. Vomiting, increased appetite and thirst, a rapid heartbeat, problems with vision, and other symptoms are signs of hyperglycemia, a diabetic symptom. Serious health issues might result from untreated hyperglycemia.

What is a healthy blood sugar level?

Sugar levels around 140 ppm (7.8 mold/L) are considered normal. After two hours, a result of greater above 200 mg/dL (11.1 meq) indicates diabetes. You have prediabetes if your blood sugar level is between 140 or 199 mg/dL (7.8 molar ratio and 11.0 mmol/L).

To know more about glucose visit

https://brainly.com/question/13052538

#SPJ4

Based on Figure 1, which of the following statements best predicts the effect that a change from a moderately acidic environment (pH near 6) to a basic environment will have on peroxidase activity ?
O Peroxidase activity will decrease.
O Peroxidase activity will increase.
O Peroxidase activity will stay the same.
O Peroxidase activity will increase at first and then decrease.

Answers

The effect that a change from a moderately acidic environment (pH near 6) to a basic environment will have on O Peroxidase activity will decrease.

What is  Peroxidase activity?Demonstrated that the performance of hydrogen peroxidase was greatly affected by all three factors, temperature, concentration level, and pH.The peroxidases are enzymes whose primary function is to oxidize hydrogen donors at the expense of peroxides. They are highly specific for hydrogen peroxide, but they accept a wide range of hydrogen donors, including polyphenols.Thyroid peroxidase also called as thyroperoxidase (TPO) is mainly expressed in thyroid organs. It is a large transmembrane glycoprotein with covalently linked haem, present in cells on the apical membranePeroxidase activity was pH-dependent, with complete inactivation at pH 2.5 and when 8.5  The maximum enzyme activity observed at pH 6.5 decreased when the pH was reduced or increased; the drop was sharper in the alkaline than in the acid range

To learn more about Peroxidase activity refers to:

https://brainly.com/question/18960396

#SPJ1

When examining the genetic code, it is apparent that ________.
O there are 44 stop codons because there are only 20 amino acids
O AUG is a terminating codon
O there can be more than one codon for a particular amino acid
O the code is ambiguous in that the same codon can code for two or more amino acids
O there can be more than one amino acid for a particular codon

Answers

When examining the genetic code, it is apparent that: There can be more than one codon for a particular amino acid.

The genetic code is a set of rules used by living cells to convert information held in genetic material (nucleotide triplet sequences, or codons) into proteins.

The ribosome joins proteinogenic amino acids in the order prescribed by messenger RNA (mRNA), transporting amino acids and reading the mRNA three nucleotides at a time. The genetic code is relatively similar among all creatures and may be stated in a simple table with 64 items.

Learn more about  genetic code to visit this link

https://brainly.com/question/29413263

#SPJ4

HURRY I NEED HELP PLEASE ​

Answers

At its typical boiling point of 100°C, water has a vaporizing heat of 2260Jg⁻¹. This indicates that for water to convert from 1 g of liquid at 100°C to 1 g of steam at 100°C, it must absorb 2260 J of temperature.

What is the name of environment?

An ecosystem, often known as the environment, is a natural system made up of all living things—plants, animals, and microbes—as well as all inanimate objects (abiotic components) that make up the environment.

Why is the environment so crucial?

The status of the environment has a direct impact on human health and wellbeing. Good natural settings provide our fundamental requirements by providing fresh water, clean air, and a hospitable climate for growing food.

To know more about Environment visit:

https://brainly.com/question/27350747

#SPJ1

Please helppp me its due tomorrow’s ‼️‼️ ☹️☹️

I only need help with g. It’s the last one

Thank youuu sooo muchhh

Answers

the answer to your question is yes

How do oxygen and carbon dioxide play different roles in the ocean?

Answers

In the ocean, For respiration, marine organisms use oxygen, which converts carbohydrates into energy and produces carbon dioxide and water as byproducts.

For marine life, dissolved oxygen and carbon dioxide are essential. Through the process of photosynthesis, marine plants utilize dissolved carbon dioxide, sunlight, and water to produce carbohydrates. The water gets oxygen from this process. All marine organisms respire with oxygen, which breaks down carbohydrates into energy and produces carbon dioxide and water as byproducts. These organs are utilized by fish and other marine animals with gills to extract oxygen from seawater.

Know more about photosynthesis here: https://brainly.com/question/29764662

#SPJ4

Imagine you are playing baseball and a line drive comes out of nowhere. You do not even realize till the last second that it is heading for your face! explain the reflex type of movement you would experience. Describe the nervous system's reaction from sensing the stimuli to response. ​

Answers

When a line drive unexpectedly comes barreling towards you on the baseball field, your reflexes take over.

Your nervous system quickly senses the stimuli of the incoming line drive and sends a signal to your muscles to move out of the way.

You may not even notice the ball coming until the last second, but your body instinctively knows to act quickly and respond.

You may duck, jump, or move to the side to avoid the ball, all in a fraction of a second. This is the result of your body's reflexive response to the stimuli it has received. Without thinking, your body is able to react and protect you from harm.

To learn more about reflex, click here:

https://brainly.com/question/17261833

#SPJ4

A need is to a physiological state as a drive is to a(n)
a. innate state.
b. psychological state.
c. physical state.
d. biological state.

Answers

B) Similar to how a drive is to a psychological state, a need is to a physiological state.

What is an illustration of a mental state?

Perception, bodily awareness, thought, belief, desire, motivation, intention, deliberation, decision, pleasure, emotion, mood, imagination, and memory are all examples of mental states. While some of these types are clearly distinguished from one another, others may overlap.

What are the four different states of mind?

There are four distinct states of mind when you combine the types of focus (internal and external) with the ways we focus (helpful and harmful): critical, engaged, and on autopilot.

To learn more about physiological state here:

https://brainly.com/question/26121405

#SPJ1

What are the factors that influence you to engage pre marital sex?

Answers

Teenagers may date outside of their parents' unions for a number of reasons, including as their self-perception, religious beliefs, financial status, media exposure, parental views, societal pressure, and cultural background.

Teenagers are more prone to turn to a sexual relationship for solace if they feel incomplete, inadequate, or underappreciated. However, those who lead happy lives, full of cherished family traditions, enjoyable pastimes, and, most importantly, unshakable love and acceptance, are less likely to act inappropriately during sexual encounters as a result of a preoccupation with fulfilment. Others who have a strong, increasing faith in God are more likely to have inherent tendencies to value and protect sex as a gift and to respect people rather than exploit them. Take note of these specific teen risk factors.

Learn more about primatial sex at

https://brainly.com/question/29795968?referrer=searchResults

#SPJ4

What are the two factors that may affect active site and enzyme function?

Answers

The first factor is temperature; normally, a reaction is sped up or slowed down depending on the temperature. The second factor is pH; each enzyme has a preferred pH range. these two factors affect the active site and enzyme function.

What is temperature?

The average kinetic energy of a system is measured by its temperature. The kinetic energy of a system starts to rise as the particle's velocity increases, which raises the system's temperature. The energy that is transferred when two bodies with different surface temperatures come in touch is referred to as heat.

What are enzymes?

Proteins called enzymes serve as biological catalysts by quickening chemical reactions. Substrates are the molecules that enzymes can interact with, and the enzyme changes the substrates into other molecules known as products.

What is the active site?

The area of an enzyme where substrate molecules bind and undergo a chemical reaction is known as the active site. The amino acid residues that make up the active site are those that catalyze the reaction of the substrate and those that temporarily binds with the substrate.

To know more about the active site, check out:

https://brainly.com/question/1831627

#SPJ1

Occasionally cells stop dividing and enter another phase, G 0 . If you damage your liver, new liver cells can be produced to replace up to 75% of the liver. However, if you sustain brain dam-age, your body does not produce new brain cells. Explain this observation using what you have learned about the cell cycle.

Answers

Cell division is essential for growth and development of organisms. Cell division is regulated by the cell cycle, which consists of four phases: G1, S, G2, and M.

During G1, the cell grows and performs its normal activities. The S-phase is when the cell makes DNA. The cell gets ready to divide during G2. The cell divides into two daughter cells during the M-phase.

Occasionally, cells enter a resting phase called G0. This phase is characterized by the cell not actively growing and dividing. Cells in this phase are usually post-mitotic, meaning they are not planning to divide anymore and have exited the cell cycle.

Liver cells can divide and enter the cell cycle and produce new cells if the liver is damaged, up to 75%. This is possible because liver cells are bi-potent, meaning they have the potential to divide and create new liver cells. On the other hand, brain cells are post-mitotic and cannot enter the cell cycle and divide. Therefore, if the brain is damaged, it cannot produce new brain cells since they are not able to divide.

To learn more about Cell division visit:

https://brainly.com/question/13312481

#SPJ4

What describes the meeting of organisms that have different homozygous alleles for a single trait?

Answers

The term "monohybrid cross" refers to the mating of organisms with various identical alleles for the same characteristic of a single trait. Thus the correct answer is (A). Monohybrid cross.

Two organisms that have different variations at the same genetic locus are combined to form a monohybrid cross. In a monohybrid cross, two or more mutations at a single gene locus control the character(s) under examination. To carry out such a cross, each parent is chosen to be homozygous or true breeding for a specific trait (locus). The monohybrid ratio, also known as the distribution of second-generation (F2) offspring, is often used to determine if a cross qualifies as a monohybrid cross. It shows a cross between two separate parents, each of whom possesses distinct features and different alleles of the same set of genes. In this creature, two identical genes occur in several forms. A monohybrid cross is created when different organisms with varied identical pair genes for the same trait mate.

The complete question is:

What describes the meeting of organisms that have different homozygous alleles for a single trait?

(a). monohybrid cross

(b). dihybrid cross

(c). homozygous cross

(d). heterozygous cross

To learn more about monohybrid cross please click on the given link: https://brainly.com/question/2228062

#SPJ4

How can a cup of water decrease in temperature? please answer my question in a scientific method, the questions will be below.

Step 1: Observation

Step 2: Research:

Step 3: Hypothesis:

Step 4: Experiment – explain the experiment that you would perform

Step 4a- The control variable

Step 4b- The dependent variable

Step 4c- The independent variable

Step 5- What do you predict the conclusion to be?

Answers

The first step for this experiment is observation where it is found that a cup of water decreases in temperature. The rest of the steps are described in the explanation part.

What is a Scientific method?

A scientific method may be characterized as the process of objectively establishing facts through testing and experimentation. The basic process involves making an observation, forming a hypothesis, making a prediction, conducting an experiment, and finally analyzing the results.

The second step is research in which a cup of water is placed at different temperatures where it can easily change its state from liquid to solid. The hypothesis governs that the amount of water in a cup may lower or decreases when it is exposed to several temperatures.

The experiment is performed on the basis of certain evidence and assumptions in order to predict some conclusion. The control variable is the influence of temperature. The dependent variable is the amount of water and the independent variable is the exposure to temperature.

Therefore, it is concluded that a cup of water decreases in temperature.

To learn more about the Scientific method, refer to the link:

https://brainly.com/question/497944

#SPJ1

I need help answering 2-6!! Please !!! If someone can help me that would be great!

Answers

An enzyme that digests starch into little carbohydrate molecules is called amylase. Two places generate this enzyme. In the beginning, salivary glands in our mouth produce salivary amylase, which kickstarts digestion by dissolving starch and transforming it into maltose and smaller carbohydrates.

what is an enzyme?

Proteins called enzymes aid in accelerating our bodies' chemical reactions, or metabolism. Some compounds are created, while others are broken down. Enzymes are a part of all living things. Enzymes are created by our bodies spontaneously.

A component known as an enzyme serves as a catalyst in living things, controlling the rate at which chemical processes take place without undergoing any personal change.

Different Digestive Enzyme Types

Amylase.

Lactase.

Lipase.

Proteases.

Sucrase.

Enzymes are categorised by the sort of reaction they are employed to catalyse into six functional classes, according to the International Union of Biochemists (I U B). Hydrolases, oxidoreductases, lyases, transferases, ligases, and isomerases are the six different categories of enzymes.

Read more about enzyme:

https://brainly.com/question/1596855

#SPJ1

For every described currently living species of organism, there are about ________
fossil species.
O 2
O 1/6
O 100
O 6
O 1/100

Answers

For every described currently living species of organism, there are about 1/6 fossil species.

What is fossil species?

Fossil species are species that have been preserved in the fossil record. Fossil species are usually the remains of ancient organisms that lived millions of years ago, and are found in sedimentary rocks. They provide a window into the evolutionary history of the Earth, and are important for understanding the relationships between extinct and living species. Fossil species are also used to reconstruct ancient environments and ecosystems. Fossil species can be identified by their morphology, or physical characteristics such as size and shape.

To learn more about fossil species
https://brainly.com/question/11829803
#SPJ1

Got it wrong the first time, I’m not sure and I only have 1 attempt left

It’s not survive & reproduce, and die

Answers

As habitats change, some organisms survive and reproduce, move out of the habitat, die options are correct.

How do animals adapt to changing environmental conditions?

There are only three ways for animals to respond to climate change: they can move, adapt, or die. In an effort to escape the warming temperatures, many animals are moving to higher altitudes and latitudes, but most species may not be able to outrun the changing climate in time.

Alteration of the local environmental conditions that a specific organism lives in. Natural occurrences that can change habitat include droughts, illnesses, fires, hurricanes, mudslides, volcanoes, earthquakes, slight variations in seasonal temperature or precipitation, etc.

To know more about habitats visit:

https://brainly.com/question/15125194

#SPJ1

Part D: Consider Constraints
What limitations will there be to building an eco-friendly home in this neighborhood? Consider social, financial, and climate constraints while determining these limitations.

Answers

Social constraints such as zoning regulations and community resistance, financial constraints such as the cost of materials and labor, and climate constraints such as the availability of renewable energy resources and the local weather patterns.

What are limitations of eco-friendly home?

Eco-friendly homes may have limitations such as higher initial costs for construction or retrofitting, limited availability of certain materials and technologies, and a lack of standardization in building codes and regulations.

Additionally, some eco-friendly features, such as solar panels or green roofs, may not be suitable for all climates or may require regular maintenance. It's also worth noting that eco-friendly homes can be more energy-efficient but they may not be able to produce all the energy they need and they may still rely on grid energy.

Learn more about eco-friendly home, here:

https://brainly.com/question/8626176

#SPJ1

According to Porter's model, which of the following should be considered when analyzing a firm's competition? (check all that apply)
buyers
the regulations in possible host countries
suppliers
the threat of substitutes

Answers

This model states that five forces determine the level of industry’s competition and profitability. The five forces are: (1) threat of new entrants, (2) bargaining power of buyers, (3) bargaining power of suppliers, (4) threat of substitutes, and (5) rivalry among existing firms.

Porter’s model of competition is a widely accepted framework for understanding the competitive landscape of an industry. When analyzing a firm’s competition, all of these forces should be considered. For example, understanding the threat of new entrants is important because it can impact the level of competition and pricing within the industry.

Similarly, the bargaining power of buyers and suppliers can be influential in setting industry prices and margins. Additionally, the threat of substitutes should be considered, as this can affect the demand for the firm’s product or service. Finally, the regulations in possible host countries should be taken into consideration, as these can also impact the firm’s ability to enter and operate in foreign markets.

Learn more about Porter’s model at :https://brainly.com/question/28074535

#SPJ4

what's the Nucleolus function

Answers

The production and assembly of the cell's ribosomes take place in the nucleolus, a spherical component of the cell's nucleus. Ribosomal RNA genes are also translated into the nucleolus.

What is a nucleolus?

A lengthy ribosomal RNA (rRNA) precursor molecule is translated from DNA in the nucleolus, where it is converted into three mature RNAs.

Assembled with particular proteins to form the big and small ribosomal subunits.

A section of the nucleus is known as the nucleolus. It is not encircled by a membrane, unlike the nucleus.

Therefore, ribosomal RNA genes are also translated into the nucleolus.

Learn more about nucleolus, here:

https://brainly.com/question/17975136

#SPJ1

the spindles contain cellulose microfibrils in addition to microtubules, whereas animal spindles do not contain microfibrils

Answers

In humans, sister chromatids are distinct from one another, although they are identical in animals: Animal spindles lack microfibrils, but the spindles in the spindles contain both microtubules and microfibrils.

A tiny, hollow tube-like structure that can be discovered in the cytoplasm of both plant and animal cells. The form of a cell is supported in part by microtubules. Animal cells have cytoplasmic microtubules that resemble the mitotic spindle fibres and are linked to centriole satellites. The existence of these proteins and their potential contribution to cell shape maintenance are examined. Spindle fibres protrude from the centrioles in animal cells. However, spindle fibres arise from the cell's centrosome area in plant cells, which do not have centrioles.

Learn more about spindle here:

https://brainly.com/question/10383318

#SPJ4

In the united states, the vast majority of adult men and women fall in the 12" range of height between feet and feet

Please help

Answers

In the United States, the vast majority of adult men and women fall in the range of 12 cm from 5 ft 9 inches for men to 5 ft 4 inches for women.

Women are around 12 centimeters shorter than men overall. The average age-adjusted height for American men aged 20 and up, according to the Centers for Disease Control and Prevention (CDC), was 69.1 inches (175.4 cm) during 2015 and 2016. Approximately 5 feet 9 inches tall, then. This sum is based on information released in December 2018. In the United States, women are typically 5 feet 4 inches tall (or 63.7 inches tall).

Anthropometry is the study of measurements of the human body, such as weight, height while standing, and skinfold thickness. Anthropo is a Greek word that means "human." Metron, which meaning "measure," is where the term "metry" originates from. These measurements are used by scientists to determine averages and trends in human growth as well as to evaluate nutrition.

To know more about average heights, refer to the following link:

https://brainly.com/question/18992406

#SPJ4

what system works with the respiratory system to circulate blood and oxygen throughout the body

Answers

To obtain oxygen into the blood, its blood supply (cardiovascular system) pumps blood from of the heart to the lungs. Oxygen-depleted blood is returned to the heart through veins to restart circulation.  

                                           

 The respiratory system is supported by the circulatory system, that carries blood from and into the lungs. The circulatory system consists of the heart and blood arteries. The circulatory system assists in moving nutrients and oxygen through the lungs to the body's tissues and organs. Additionally, it aids in the removal of trash and carbon dioxide. The portion of the airway that extends below the larynx is known as the trachea (windpipe) (LAIR-inks). To keep the trachea (TRAY-kee-uh) open, its walls are lined with hard cartilage rings. Cilia that border the trachea move fluids and other objects out of the airway to prevent them from entering the lungs.

Learn more about blood

https://brainly.com/question/14781793

#SPJ4

Where is the most ATP produced in cellular respiration ?

Answers

The majority of ATP created during cellular respiration is used in the electron transport chain (oxidative phosphorylation).

Cellular respiration is the mechanism by which glucose molecules are broken down into [tex]CO_2[/tex] and [tex]H_2O[/tex] to provide energy from Adenosine Triphosphate (ATP). Additionally, cellular respiration often occurs in an organism's cells by turning the metabolic energy contained in foods into adenosine triphosphate. Additionally, it occurs in three steps, which are the TCA cycle, electron transport, and glycolysis (Oxidative phosphorylation). As a result, the stage of aerobic cellular respiration that produces the most ATPs is called oxidative phosphorylation.

Normally, ATP releases energy by dismantling any weak phosphate cells that may be present. The energy that is released as the phosphate cell disintegrates is then put to use. ADP is created after ATP.

For more such question on ATP produced.

https://brainly.com/question/787522

#SPJ4

What are the characteristics of the central nervous system?
a. it is made up of the brain and spinal cord.
b. it is a system of bones that supports the body.
c. it uses the spinal cord as a pathway to transmit messages to the pns.
d. it contains networks of nerves called plexuses.

Answers

The central nervous system (CNS) is the part of the nervous system that consists of the brain and the spinal cord. The CNS is responsible for receiving and interpreting information from the body and the environment.

The central nervous system is responsible for integrating information from various sources, such as the senses, and for coordinating responses to that information. The central nervous system is responsible for controlling and coordinating the actions and movements of the body, such as muscle movement and balance. The central nervous system is responsible for higher functions such as perception, thought, memory, and emotion, The brain is protected spinal cord by the skull and the spinal cord is protected by the vertebral column, which helps to protect the CNS from physical trauma. The central nervous system uses electrical and chemical signaling to communicate with the body and other spinal cord systems. The central nervous system has the ability to change and adapt in response to new experiences, a property known as neural plasticity.

learn more about central nervous system here:

https://brainly.com/question/2114466

#SPJ4

Please place answers under questions so I know which is which. Thank you! :)
What reactants are used in light-dependent reactions (photosynthesis)?

What reactants are used in light-independent reactions (photosynthesis)?

Word Bank:
Reactants: ADP, ATP, Carbon Dioxide, NADP+, NADPH, Sunlight, Water

Answers

Reactants used in light- dependent reactions : Carbon dioxide, sunlight and water.

Through tiny holes in their leaves known as stomata, plants absorb carbon dioxide from the atmosphere. Most monocot plants have stomata on both surfaces of their leaves, while dicot plants and a few monocots only have stomata on the bottom epidermis of their leaves.Plants obtain water from the soil around their roots, and water travels via the xylem, a component of the plant's vascular system, to reach the leaves. The vascular bundle in leaves houses the xylem and phloem.The carbon dioxide and water molecules enter the leaf and then migrate into the cells of the mesophyll, the ground tissue layer that lies between the top and lower epidermis. These cells perform photosynthesis using water and carbon dioxide in organelles known as chloroplasts.

Reactants used in light- independent reactions : ATP, carbon dioxide, NADPH.

The assembly of a glucose molecule is the final step in the light-independent processes, also known as the Calvin cycle. This stage of photosynthesis necessitates the CO2 that the plant absorbs from the atmosphere.In essence, the plant requires the carbon in the CO2 to make the components of glucose. RubP (ribulose biphosphate), a molecule with five carbons, and a molecule of carbon dioxide are combined by an enzyme called ruBisCo in the stroma. As a result, a six-carbon molecule is produced, which is then split into two three-carbon molecules (3-phosphoglycerate). The term "carbon fixation" refers to this phase of the light-independent processes.Then the light-dependent processes' energy carriers start to contribute. By adding a hydrogen atom to each 3-phosphoglycerate, ATP and NADPH produce two molecules of the simple sugar G3P. (glyceraldehyde-3-phosphate). In the end, one molecule of glucose is created from these two G3P molecules. Due to the addition of electrons, this phase of the light-independent processes is commonly referred to as reduction (or decreasing the sugar).

6. Prepare a dichotomous key for the five fish in Figure 3.
REMEMBER: 1.) Each step has only two options. 2.) The options should be about the same characteristic.
Instead of ending with the family name for these fish, you should end with the numbers I, II, III, IV, and V. To
help you get started, I have given you the first pair of statements.
1.A.
B.
2.A.
Figure 3.
If the fish has a long, tube like body
If the fish does not have a tube like body
IV
******

Answers

The fish has a long tube like body is I and does not have tube like body is II, III, IV, and V based on dichotomous key.

What traits are used to categorize fishes using a dichotomous key?

A dichotomous key is a crucial piece of scientific equipment used to distinguish between various species based on their observable characteristics. Dichotomous keys are a set of statements with two options for each stage that guide users to the right identification.

2 A & B. The fish has a pointed mouth is I and does not have pointed mouth is II, III, IV, and V.

3 A & B. The fishes have a flat body shape is II and V and does not have flat body shape is I, III, and IV.

Which three categories of dichotomous keys exist?

The nested, connected, and branched dichotomous keys are the three common varieties of dichotomous keys. The answer to each sentence is given in the nested type, nestled immediately next to it. We employ lists of text to identify objects in the linked kinds. To create the dichotomous key in the branched type, we employ a tree diagram.

Learn more about dichotomous key here:

brainly.com/question/2235448

#SPJ1

What type is monggo?

Answers

Monggo or mung bean are the seeds that belong to the legume family of plants.

Monggo is the another name for the mung bean plant. It is a green colored lentil known for its high nutrition content. The common regions where the cultivation of monggo takes place is East, Southeast and South Asia. The monggo is a legume plant.

Legume is the term that refers to the plants of the family Fabaceae. It is characterized by the presence of seeds inside a pod. These seeds are usually edible. The examples include beans, lentils, and peas. These plant form root nodules for nitrogen fixation.

To know more about legume, here

brainly.com/question/19900764

#SPJ4

which of the following statements are true about purines and pyrimidines? A)purines have one-ringed base
B) Guanine is a pyrimidine
c) PURINES HAVE TWO-RINGED BASE
D) pyrimidines have a two-ringed base
E) Adenine is a purine
F) Thymine is a purine
G) Uracil is a pyrimidine
H) pyrimidine has a one-ringed base

Answers

The answer would be C
Other Questions
Which challenge requires the instructor to work with superiors to affect change within organizations Sonja has always been intrigued with the beauty of the French language. She has the opportunity to study French as one of her electives. Which strategy will most likely help maintain Sonja's motivation as she learns French Summary chapter 5 green days by the river Percent | Word Problems1) Mrs. Smith has covered 50 miles of a 125-mile journey. What percentage of thejourney has been covered by her? how long after closing the switch s will the potential across each capacitor be reduced to 15.0 v ? Why is the ending in the story the necklace considered a surprise ending? why majority of lakes in Ethiopia do are clustered in rift valley system Notice the two possible arrangements of chromo-somes in late prophase I. Considering what you know about DNA replication and meiosis, is either arrangement equally likely during the formation of tetrads in late prophase I Problem Statement We have a two-dimensional board game involving snakes. The board has two types of squares on it: +'s represent impassable squares where snakes cannot go, and 0's represent squares through which snakes can move. Snakes may move in any of four directions - up, down, left, or right - one square at a time, but they will never return to a square that they've already visited. If a snake enters the board on an edge square, we want to catch it at a different exit square on the board's edge. The snake is familiar with the board and will take the route to the nearest reachable exit, in terms of the number of squares it has to move through to get there. Write a function that takes a rectangular board with only +'s and 0 's, along with a starting point on the edge of the board (given row first, then column), and returns the coordinates of the nearest exit to which it can travel. If multiple exits are equally close, give the one with the lowest numerical value for the row. If there is still a tie, give the one of those with the lowest numerical value for the column. If there is no answer, output11The board will be non-empty and rectangular. All values in the board will be either+or 0 . All coordinates (input and output) are zero-based. All start positions will be 0 , and be on the edge of the board. For example,(0,0)would be the top left corner of any size input. Example Input Consider the following board: If a snake starts at the edge on the left (row 2 column 0 ), the snake will take the following path to another edge square (an exit) If the snake starts where the last one ended (row 5 column 2), the snake has two paths of length 5: What are the legal implications for retaining or returning the Elgin Marbles? Which model represents 2 x 0.9? You answer a call from a number of users who cannot access the mail server. Which utility would you use to quickly see if the sendmail service is running? During 2017, company XYZ had sales 252189; costs 130794; depreciation expense 43813; interest expense 19808; tax rate 35 percent. Given this information what is company XYZ net income Two sidesOf the x that are multiplied together to get the top number of the x but added together to get the bottom number of the x like 24 too 25 on bottom What are the four elements of common law? helpppp fasttttttttt pleaseeeeeeeee How many moles of magnesium atoms react with 1 mole of oxygen molecules? Write a method that takes a Rectangle as a parameter, and changes the width so it becomes a square (i.e. the width is set to the value of the length). This method must be called makeSquare() and it must take a Rectangle parameter. You can call your method in the program's main method so you can test whether it works, but you must remove or comment out the main method before checking your code for a score. For example, if the following code appeared in your main method, the output should be Rectangle with length 4.0, width 4.0 Rectangle r = new Rectangle(4.0, 7.0); makeSquare(r); System.out.println(r); To reference the documentation for the Rectangle class, A ? is a traditional tool used to align and mark vertical points from top to bottom.Select one:a. compassb. plumb bobc. protractord. ruler What is the text structure used in the passage?